Incidental Mutation 'R5248:Mybpc3'
ID398614
Institutional Source Beutler Lab
Gene Symbol Mybpc3
Ensembl Gene ENSMUSG00000002100
Gene Namemyosin binding protein C, cardiac
Synonymscardiac C-protein
MMRRC Submission 042819-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.791) question?
Stock #R5248 (G1)
Quality Score204
Status Not validated
Chromosome2
Chromosomal Location91118144-91136516 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to A at 91125228 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111430] [ENSMUST00000137942] [ENSMUST00000169776]
Predicted Effect probably null
Transcript: ENSMUST00000111430
SMART Domains Protein: ENSMUSP00000107058
Gene: ENSMUSG00000002100

DomainStartEndE-ValueType
IG 24 103 4.86e-2 SMART
low complexity region 131 143 N/A INTRINSIC
IG 167 263 2.81e-7 SMART
IG 373 453 1.25e-4 SMART
IG 463 544 2.48e-8 SMART
IG 554 640 3.16e-1 SMART
IG 659 772 3.91e-6 SMART
FN3 775 858 2.5e-11 SMART
FN3 873 956 7.06e-11 SMART
IG 983 1066 3.3e-4 SMART
FN3 1069 1151 4.38e-7 SMART
IGc2 1196 1263 6.21e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000137942
SMART Domains Protein: ENSMUSP00000119994
Gene: ENSMUSG00000002100

DomainStartEndE-ValueType
IG 3 99 2.81e-7 SMART
low complexity region 135 152 N/A INTRINSIC
IG 209 289 1.25e-4 SMART
IG 299 380 2.48e-8 SMART
IG 390 476 3.16e-1 SMART
IG 495 608 3.91e-6 SMART
FN3 611 694 2.5e-11 SMART
FN3 709 792 7.06e-11 SMART
IG 819 902 3.3e-4 SMART
FN3 905 987 4.38e-7 SMART
IGc2 1032 1099 6.21e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000169776
SMART Domains Protein: ENSMUSP00000127070
Gene: ENSMUSG00000002100

DomainStartEndE-ValueType
IG 24 103 4.86e-2 SMART
low complexity region 131 143 N/A INTRINSIC
IG 167 263 2.81e-7 SMART
IG 374 454 1.25e-4 SMART
IG 464 545 2.48e-8 SMART
IG 555 641 3.16e-1 SMART
IG 660 773 3.91e-6 SMART
FN3 776 859 2.5e-11 SMART
FN3 874 957 7.06e-11 SMART
IG 984 1067 3.3e-4 SMART
FN3 1070 1152 4.38e-7 SMART
IGc2 1197 1264 6.21e-9 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MYBPC3 encodes the cardiac isoform of myosin-binding protein C. Myosin-binding protein C is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. MYBPC3, the cardiac isoform, is expressed exclussively in heart muscle. Regulatory phosphorylation of the cardiac isoform in vivo by cAMP-dependent protein kinase (PKA) upon adrenergic stimulation may be linked to modulation of cardiac contraction. Mutations in MYBPC3 are one cause of familial hypertrophic cardiomyopathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for null or truncated mutations exhibit cardiac abnormalities such as cardiac hypertrophy, dilated cardiomyopathy, abnormal cardiac muscle contractility and relaxation, disorganized myocardium, and cardiac fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,109,438 E344D probably benign Het
Acoxl G A 2: 128,075,935 probably null Het
Adora1 A T 1: 134,203,486 L149Q possibly damaging Het
Aebp1 C A 11: 5,868,501 D115E possibly damaging Het
Ank3 A G 10: 69,987,108 I1819V probably benign Het
Ankrd44 T C 1: 54,667,380 H454R probably damaging Het
Ap4e1 C T 2: 127,064,922 A1034V possibly damaging Het
B3galt2 T A 1: 143,647,111 F328L probably benign Het
Bbip1 G A 19: 53,931,355 probably benign Het
Brsk1 G A 7: 4,708,866 E572K possibly damaging Het
Clca3a1 G T 3: 144,737,136 P716T possibly damaging Het
Clpx T C 9: 65,320,850 V380A probably damaging Het
Epha3 T A 16: 63,598,257 Q608H probably damaging Het
Gprc6a G T 10: 51,614,993 P712T probably damaging Het
Itpr1 C A 6: 108,542,062 Q2720K probably damaging Het
Kdm5b A G 1: 134,620,997 E1080G probably benign Het
Macf1 G A 4: 123,401,774 R3163* probably null Het
Map4k5 T C 12: 69,841,981 D292G probably benign Het
Mau2 A T 8: 70,028,723 C217S probably benign Het
Mtf1 T C 4: 124,820,427 F210L probably damaging Het
Mtif2 G A 11: 29,536,889 V300M probably damaging Het
Mtmr2 T C 9: 13,783,609 probably benign Het
Ncmap T C 4: 135,380,119 probably null Het
Nek9 A G 12: 85,308,977 F672S probably damaging Het
Nuak1 A T 10: 84,409,678 I101N probably damaging Het
Olfr285 T C 15: 98,313,430 N40S probably damaging Het
Pcdh7 T A 5: 58,129,173 M1197K probably damaging Het
Pcdhb17 A C 18: 37,485,886 Q243P probably benign Het
Pcf11 T G 7: 92,661,491 K221Q probably damaging Het
Pkhd1 C T 1: 20,534,545 R1182H probably benign Het
Ptprz1 C A 6: 23,001,901 P1330Q probably benign Het
Rbm33 T G 5: 28,337,052 probably null Het
Rhobtb1 A G 10: 69,248,785 D2G probably damaging Het
Rngtt T A 4: 33,325,110 C110* probably null Het
Setx T A 2: 29,148,418 N1638K probably benign Het
Slc24a3 A T 2: 145,604,517 M282L probably benign Het
Slc7a1 A T 5: 148,333,988 V556D possibly damaging Het
Sppl2c A T 11: 104,186,581 D69V possibly damaging Het
Srpk3 C T X: 73,774,949 R82* probably null Het
Tas2r120 A T 6: 132,657,147 N64I probably damaging Het
Tcf25 G T 8: 123,373,939 A23S probably damaging Het
Tigd2 A T 6: 59,211,153 K335I probably damaging Het
Tlr6 A G 5: 64,955,304 S87P probably benign Het
Tmem135 T A 7: 89,147,992 Y352F probably damaging Het
Tob2 T C 15: 81,851,717 Y17C probably damaging Het
Tymp GC GCC 15: 89,374,364 probably null Het
Vmn1r179 T C 7: 23,929,053 V223A probably damaging Het
Zfp946 T C 17: 22,454,466 V67A probably benign Het
Zswim4 G T 8: 84,219,932 N698K probably benign Het
Zzz3 A G 3: 152,427,545 Q80R probably damaging Het
Other mutations in Mybpc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Mybpc3 APN 2 91120029 missense probably benign
IGL00985:Mybpc3 APN 2 91135359 missense probably benign 0.16
IGL01926:Mybpc3 APN 2 91135407 missense possibly damaging 0.61
IGL02135:Mybpc3 APN 2 91124826 missense possibly damaging 0.58
IGL02187:Mybpc3 APN 2 91135452 missense probably benign
IGL02219:Mybpc3 APN 2 91121023 critical splice acceptor site probably null
IGL02752:Mybpc3 APN 2 91132637 critical splice acceptor site probably null
IGL03002:Mybpc3 APN 2 91123889 missense probably damaging 1.00
IGL03118:Mybpc3 APN 2 91124503 missense probably damaging 1.00
IGL03238:Mybpc3 APN 2 91131659 missense probably damaging 1.00
R0010:Mybpc3 UTSW 2 91134833 nonsense probably null
R0114:Mybpc3 UTSW 2 91124494 missense probably damaging 1.00
R0139:Mybpc3 UTSW 2 91120337 splice site probably benign
R0282:Mybpc3 UTSW 2 91124024 splice site probably benign
R0673:Mybpc3 UTSW 2 91120427 missense probably damaging 1.00
R1388:Mybpc3 UTSW 2 91122874 missense probably benign 0.43
R2159:Mybpc3 UTSW 2 91125370 missense probably damaging 1.00
R2424:Mybpc3 UTSW 2 91135793 missense probably benign 0.20
R3983:Mybpc3 UTSW 2 91135369 missense probably benign
R4322:Mybpc3 UTSW 2 91123961 missense possibly damaging 0.87
R4909:Mybpc3 UTSW 2 91134812 missense probably benign
R4913:Mybpc3 UTSW 2 91126264 missense possibly damaging 0.46
R4965:Mybpc3 UTSW 2 91119247 missense possibly damaging 0.50
R5311:Mybpc3 UTSW 2 91128678 nonsense probably null
R5332:Mybpc3 UTSW 2 91122938 missense probably damaging 1.00
R5635:Mybpc3 UTSW 2 91134829 missense probably benign 0.00
R5647:Mybpc3 UTSW 2 91121722 splice site probably null
R5698:Mybpc3 UTSW 2 91124849 missense possibly damaging 0.85
R5832:Mybpc3 UTSW 2 91119175 splice site probably null
R5895:Mybpc3 UTSW 2 91124665 missense probably damaging 0.99
R6833:Mybpc3 UTSW 2 91125428 splice site probably null
R7061:Mybpc3 UTSW 2 91125404 missense possibly damaging 0.93
R7144:Mybpc3 UTSW 2 91134604 missense probably benign 0.03
Z1088:Mybpc3 UTSW 2 91135359 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GATACCATGACCTCAGCTTCC -3'
(R):5'- CTTTATGCGGTTGTCAGGCAC -3'

Sequencing Primer
(F):5'- TGCTGAAGTATACCCTGCAG -3'
(R):5'- GGTTGTCAGGCACCAGTTC -3'
Posted On2016-07-06