Incidental Mutation 'R5248:Rngtt'
ID398626
Institutional Source Beutler Lab
Gene Symbol Rngtt
Ensembl Gene ENSMUSG00000028274
Gene NameRNA guanylyltransferase and 5'-phosphatase
Synonymsmouse capping enzyme
MMRRC Submission 042819-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R5248 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location33310311-33502614 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 33325110 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 110 (C110*)
Ref Sequence ENSEMBL: ENSMUSP00000103788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029942] [ENSMUST00000108153]
PDB Structure
CRYSTAL STRUCTURE OF THE RNA TRIPHOSPHATASE DOMAIN OF MOUSE MRNA CAPPING ENZYME [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE OXIDIZED RNA TRIPHOSPHATASE DOMAIN OF MOUSE MRNA CAPPING ENZYME [X-RAY DIFFRACTION]
Crystal structure of mammalian capping enzyme (Mce1) and Pol II CTD complex [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000029942
AA Change: C110*
SMART Domains Protein: ENSMUSP00000029942
Gene: ENSMUSG00000028274
AA Change: C110*

DomainStartEndE-ValueType
Pfam:DSPc 46 179 4.7e-12 PFAM
low complexity region 195 205 N/A INTRINSIC
Pfam:mRNA_cap_enzyme 272 460 1.8e-73 PFAM
Pfam:mRNA_cap_C 463 550 3.7e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108153
AA Change: C110*
SMART Domains Protein: ENSMUSP00000103788
Gene: ENSMUSG00000028274
AA Change: C110*

DomainStartEndE-ValueType
Pfam:DSPc 47 179 2.2e-13 PFAM
low complexity region 195 205 N/A INTRINSIC
Pfam:mRNA_cap_enzyme 272 460 2e-80 PFAM
Pfam:mRNA_cap_C 464 559 1.9e-22 PFAM
low complexity region 577 590 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130138
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155397
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,109,438 E344D probably benign Het
Acoxl G A 2: 128,075,935 probably null Het
Adora1 A T 1: 134,203,486 L149Q possibly damaging Het
Aebp1 C A 11: 5,868,501 D115E possibly damaging Het
Ank3 A G 10: 69,987,108 I1819V probably benign Het
Ankrd44 T C 1: 54,667,380 H454R probably damaging Het
Ap4e1 C T 2: 127,064,922 A1034V possibly damaging Het
B3galt2 T A 1: 143,647,111 F328L probably benign Het
Bbip1 G A 19: 53,931,355 probably benign Het
Brsk1 G A 7: 4,708,866 E572K possibly damaging Het
Clca3a1 G T 3: 144,737,136 P716T possibly damaging Het
Clpx T C 9: 65,320,850 V380A probably damaging Het
Epha3 T A 16: 63,598,257 Q608H probably damaging Het
Gprc6a G T 10: 51,614,993 P712T probably damaging Het
Itpr1 C A 6: 108,542,062 Q2720K probably damaging Het
Kdm5b A G 1: 134,620,997 E1080G probably benign Het
Macf1 G A 4: 123,401,774 R3163* probably null Het
Map4k5 T C 12: 69,841,981 D292G probably benign Het
Mau2 A T 8: 70,028,723 C217S probably benign Het
Mtf1 T C 4: 124,820,427 F210L probably damaging Het
Mtif2 G A 11: 29,536,889 V300M probably damaging Het
Mtmr2 T C 9: 13,783,609 probably benign Het
Mybpc3 C A 2: 91,125,228 probably null Het
Ncmap T C 4: 135,380,119 probably null Het
Nek9 A G 12: 85,308,977 F672S probably damaging Het
Nuak1 A T 10: 84,409,678 I101N probably damaging Het
Olfr285 T C 15: 98,313,430 N40S probably damaging Het
Pcdh7 T A 5: 58,129,173 M1197K probably damaging Het
Pcdhb17 A C 18: 37,485,886 Q243P probably benign Het
Pcf11 T G 7: 92,661,491 K221Q probably damaging Het
Pkhd1 C T 1: 20,534,545 R1182H probably benign Het
Ptprz1 C A 6: 23,001,901 P1330Q probably benign Het
Rbm33 T G 5: 28,337,052 probably null Het
Rhobtb1 A G 10: 69,248,785 D2G probably damaging Het
Setx T A 2: 29,148,418 N1638K probably benign Het
Slc24a3 A T 2: 145,604,517 M282L probably benign Het
Slc7a1 A T 5: 148,333,988 V556D possibly damaging Het
Sppl2c A T 11: 104,186,581 D69V possibly damaging Het
Srpk3 C T X: 73,774,949 R82* probably null Het
Tas2r120 A T 6: 132,657,147 N64I probably damaging Het
Tcf25 G T 8: 123,373,939 A23S probably damaging Het
Tigd2 A T 6: 59,211,153 K335I probably damaging Het
Tlr6 A G 5: 64,955,304 S87P probably benign Het
Tmem135 T A 7: 89,147,992 Y352F probably damaging Het
Tob2 T C 15: 81,851,717 Y17C probably damaging Het
Tymp GC GCC 15: 89,374,364 probably null Het
Vmn1r179 T C 7: 23,929,053 V223A probably damaging Het
Zfp946 T C 17: 22,454,466 V67A probably benign Het
Zswim4 G T 8: 84,219,932 N698K probably benign Het
Zzz3 A G 3: 152,427,545 Q80R probably damaging Het
Other mutations in Rngtt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01865:Rngtt APN 4 33325157 splice site probably benign
IGL01945:Rngtt APN 4 33339073 missense probably damaging 1.00
IGL02104:Rngtt APN 4 33320517 critical splice acceptor site probably null
IGL02505:Rngtt APN 4 33337936 missense possibly damaging 0.75
IGL02679:Rngtt APN 4 33356098 missense possibly damaging 0.65
IGL03309:Rngtt APN 4 33339091 missense probably damaging 1.00
R0013:Rngtt UTSW 4 33379409 missense probably benign 0.01
R0626:Rngtt UTSW 4 33329598 splice site probably null
R0633:Rngtt UTSW 4 33368690 missense probably damaging 1.00
R1645:Rngtt UTSW 4 33362939 missense probably damaging 1.00
R1670:Rngtt UTSW 4 33368660 missense probably benign
R1700:Rngtt UTSW 4 33330864 missense probably damaging 1.00
R1754:Rngtt UTSW 4 33329634 intron probably null
R1809:Rngtt UTSW 4 33443614 missense probably benign 0.04
R1929:Rngtt UTSW 4 33500302 nonsense probably null
R2271:Rngtt UTSW 4 33500302 nonsense probably null
R2844:Rngtt UTSW 4 33368678 missense probably benign
R3773:Rngtt UTSW 4 33330889 missense probably damaging 1.00
R4445:Rngtt UTSW 4 33499035 missense probably benign
R4449:Rngtt UTSW 4 33330865 missense probably damaging 1.00
R4510:Rngtt UTSW 4 33339032 missense possibly damaging 0.88
R4511:Rngtt UTSW 4 33339032 missense possibly damaging 0.88
R4578:Rngtt UTSW 4 33339050 missense probably benign 0.30
R4610:Rngtt UTSW 4 33339133 intron probably benign
R4712:Rngtt UTSW 4 33379394 missense probably benign 0.00
R4888:Rngtt UTSW 4 33500335 missense unknown
R4911:Rngtt UTSW 4 33500292 splice site probably null
R6429:Rngtt UTSW 4 33320606 nonsense probably null
R6571:Rngtt UTSW 4 33379413 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTTCTATGACAGAAATGACATAGA -3'
(R):5'- GAGGTCATCCCACACTCTGT -3'

Sequencing Primer
(F):5'- GAGTGAAAGCTTTCATTGAGG -3'
(R):5'- TAGTGAGAGACCTCCTGACTTGAC -3'
Posted On2016-07-06