Incidental Mutation 'R0454:Zscan21'
ID39863
Institutional Source Beutler Lab
Gene Symbol Zscan21
Ensembl Gene ENSMUSG00000037017
Gene Namezinc finger and SCAN domain containing 21
SynonymsRU49, Zipro1, Zfp38, CTfin51, Zfp-38
MMRRC Submission 038654-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0454 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location138116903-138134265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 138133603 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 463 (I463T)
Ref Sequence ENSEMBL: ENSMUSP00000106586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062350] [ENSMUST00000080732] [ENSMUST00000110959] [ENSMUST00000110960] [ENSMUST00000110961]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062350
AA Change: I463T

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000053430
Gene: ENSMUSG00000037017
AA Change: I463T

DomainStartEndE-ValueType
low complexity region 28 37 N/A INTRINSIC
SCAN 118 230 1.7e-80 SMART
ZnF_C2H2 359 381 3.95e-4 SMART
ZnF_C2H2 387 409 4.87e-4 SMART
ZnF_C2H2 415 436 1.26e1 SMART
ZnF_C2H2 442 464 4.3e-5 SMART
ZnF_C2H2 470 492 3.95e-4 SMART
ZnF_C2H2 498 520 1.38e-3 SMART
ZnF_C2H2 526 548 2.2e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000080732
AA Change: I463T

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000079557
Gene: ENSMUSG00000037017
AA Change: I463T

DomainStartEndE-ValueType
low complexity region 28 37 N/A INTRINSIC
SCAN 118 230 1.7e-80 SMART
ZnF_C2H2 359 381 3.95e-4 SMART
ZnF_C2H2 387 409 4.87e-4 SMART
ZnF_C2H2 415 436 1.26e1 SMART
ZnF_C2H2 442 464 4.3e-5 SMART
ZnF_C2H2 470 492 3.95e-4 SMART
ZnF_C2H2 498 520 1.38e-3 SMART
ZnF_C2H2 526 548 2.2e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110959
AA Change: I463T

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106584
Gene: ENSMUSG00000037017
AA Change: I463T

DomainStartEndE-ValueType
low complexity region 28 37 N/A INTRINSIC
SCAN 118 230 1.7e-80 SMART
ZnF_C2H2 359 381 3.95e-4 SMART
ZnF_C2H2 387 409 4.87e-4 SMART
ZnF_C2H2 415 436 1.26e1 SMART
ZnF_C2H2 442 464 4.3e-5 SMART
ZnF_C2H2 470 492 3.95e-4 SMART
ZnF_C2H2 498 520 1.38e-3 SMART
ZnF_C2H2 526 548 2.2e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110960
AA Change: I463T

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106585
Gene: ENSMUSG00000037017
AA Change: I463T

DomainStartEndE-ValueType
low complexity region 28 37 N/A INTRINSIC
SCAN 118 230 1.7e-80 SMART
ZnF_C2H2 359 381 3.95e-4 SMART
ZnF_C2H2 387 409 4.87e-4 SMART
ZnF_C2H2 415 436 1.26e1 SMART
ZnF_C2H2 442 464 4.3e-5 SMART
ZnF_C2H2 470 492 3.95e-4 SMART
ZnF_C2H2 498 520 1.38e-3 SMART
ZnF_C2H2 526 548 2.2e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110961
AA Change: I463T

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106586
Gene: ENSMUSG00000037017
AA Change: I463T

DomainStartEndE-ValueType
low complexity region 28 37 N/A INTRINSIC
SCAN 118 230 1.7e-80 SMART
ZnF_C2H2 359 381 3.95e-4 SMART
ZnF_C2H2 387 409 4.87e-4 SMART
ZnF_C2H2 415 436 1.26e1 SMART
ZnF_C2H2 442 464 4.3e-5 SMART
ZnF_C2H2 470 492 3.95e-4 SMART
ZnF_C2H2 498 520 1.38e-3 SMART
ZnF_C2H2 526 548 2.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142185
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation appear to be phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik A G 5: 118,255,821 E88G possibly damaging Het
4930447F04Rik T C X: 66,303,668 E91G unknown Het
Acot1 A G 12: 84,017,339 Q407R probably benign Het
Adcy10 T A 1: 165,570,728 Y1465N probably damaging Het
Ahsa2 T A 11: 23,490,702 I249F probably damaging Het
Arhgap10 T C 8: 77,250,965 N721S probably damaging Het
Arrdc4 T G 7: 68,741,871 E216A probably damaging Het
Axin1 T C 17: 26,173,663 V306A probably benign Het
BC005561 T G 5: 104,518,211 S200A probably benign Het
Cct3 T C 3: 88,302,866 probably null Het
Cfap58 G A 19: 47,974,680 probably null Het
Chd9 T C 8: 90,973,231 S49P possibly damaging Het
Clcn2 C A 16: 20,710,428 probably null Het
Col26a1 T C 5: 136,754,193 N286D probably benign Het
Cpt1b T A 15: 89,424,393 I111F possibly damaging Het
Cyp4f16 T A 17: 32,537,087 I30N probably damaging Het
Ddc T G 11: 11,880,587 D19A possibly damaging Het
Depdc1a T A 3: 159,516,900 probably null Het
Evc2 T A 5: 37,417,484 C1028S possibly damaging Het
Fam228a T C 12: 4,731,457 E134G probably damaging Het
Fasl T C 1: 161,787,954 E111G probably benign Het
Fbxw10 A G 11: 62,876,738 N800S possibly damaging Het
Fras1 T C 5: 96,762,665 S3318P probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gad1 T A 2: 70,579,201 M212K probably damaging Het
Gm17455 T G 10: 60,402,973 S6A probably benign Het
Grm5 T C 7: 88,130,789 S1146P probably damaging Het
Gsn T C 2: 35,304,639 L649P probably damaging Het
H2-DMb1 A G 17: 34,155,711 T112A probably benign Het
Hcn3 T A 3: 89,152,894 I148F probably damaging Het
Hdac10 T C 15: 89,125,758 probably null Het
Hk3 C A 13: 55,008,705 D619Y probably damaging Het
Ifi44 T A 3: 151,745,497 R272S possibly damaging Het
Il1rap A C 16: 26,698,875 D275A probably damaging Het
Itgam A T 7: 128,107,980 N660I probably benign Het
Itpr3 T C 17: 27,113,819 M1853T probably benign Het
Lrmp A G 6: 145,167,984 R293G possibly damaging Het
Lrrc8c A C 5: 105,607,099 K247Q probably damaging Het
Map3k21 T C 8: 125,942,119 S815P probably benign Het
Mast4 A G 13: 102,751,560 S1114P probably damaging Het
Myh8 C T 11: 67,303,765 Q1601* probably null Het
Nhlrc2 A G 19: 56,570,527 D148G probably damaging Het
Nos1 T A 5: 117,943,320 S1196T probably benign Het
Nsmaf C T 4: 6,424,874 probably null Het
Obscn T C 11: 58,999,623 D7361G unknown Het
Olfr1350 C T 7: 6,570,360 A123V probably damaging Het
Olfr600 C A 7: 103,346,878 A17S probably benign Het
Olfr721-ps1 T C 14: 14,407,777 V183A probably damaging Het
Pank3 T G 11: 35,777,709 M175R probably benign Het
Papolg A G 11: 23,879,868 probably null Het
Pcdhb21 G A 18: 37,514,513 D232N probably damaging Het
Pcdhb22 T C 18: 37,518,872 F131S probably damaging Het
Pik3r6 G A 11: 68,528,782 A140T possibly damaging Het
Pinlyp T C 7: 24,542,522 T87A possibly damaging Het
Pld1 T C 3: 28,124,575 S873P probably damaging Het
Pld5 T A 1: 176,274,729 Y49F probably benign Het
Polq T C 16: 37,034,890 V449A probably damaging Het
Prkca A G 11: 107,978,280 V69A probably benign Het
Ptk6 A G 2: 181,202,282 S75P possibly damaging Het
Ptprq G A 10: 107,582,530 Q1662* probably null Het
Ptprt C A 2: 161,553,822 A1144S probably damaging Het
Rrm1 T A 7: 102,466,926 W684R probably damaging Het
Ryr1 T A 7: 29,036,075 M4093L probably damaging Het
Scnn1a C T 6: 125,322,226 L90F probably damaging Het
Slc25a19 G T 11: 115,617,597 Y188* probably null Het
Slc31a1 C T 4: 62,385,629 probably benign Het
Slc5a11 C G 7: 123,265,235 S351R possibly damaging Het
Slc6a17 A G 3: 107,476,867 L387P probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Spam1 T A 6: 24,797,838 L331Q probably damaging Het
Spata32 A G 11: 103,209,299 W127R probably damaging Het
Spta1 T G 1: 174,213,942 I1324S probably damaging Het
St6galnac4 A G 2: 32,594,318 Y176C probably damaging Het
Stk10 A G 11: 32,596,724 E327G probably damaging Het
Stxbp5l T A 16: 37,134,284 Y912F possibly damaging Het
Tchp G A 5: 114,720,182 E459K probably benign Het
Terf2 C T 8: 107,096,210 W100* probably null Het
Thrsp T C 7: 97,417,427 N26S probably damaging Het
Tln1 C A 4: 43,553,504 R297L probably benign Het
Tmeff2 C A 1: 50,928,075 T43N possibly damaging Het
Tmx1 C T 12: 70,453,173 A2V possibly damaging Het
Tnks1bp1 T A 2: 85,072,137 L1053Q probably damaging Het
Trmt10b A T 4: 45,304,286 K107N probably damaging Het
Trpa1 A T 1: 14,885,748 probably null Het
Trrap A G 5: 144,846,477 K3371R probably damaging Het
Tuba3b G A 6: 145,618,269 V14I probably benign Het
Usp19 T C 9: 108,494,240 probably null Het
Usp28 C A 9: 49,039,101 D615E possibly damaging Het
Utp20 T C 10: 88,822,069 D43G probably benign Het
Vmn1r58 T G 7: 5,410,998 K78Q possibly damaging Het
Vmn2r10 T C 5: 109,003,461 M96V probably benign Het
Wdr90 T C 17: 25,860,049 E273G probably damaging Het
Xpc C T 6: 91,491,226 A860T probably benign Het
Other mutations in Zscan21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00775:Zscan21 APN 5 138133048 nonsense probably null
IGL02348:Zscan21 APN 5 138133383 missense probably damaging 0.99
IGL03295:Zscan21 APN 5 138125278 missense possibly damaging 0.85
R0471:Zscan21 UTSW 5 138125140 missense probably benign 0.33
R1465:Zscan21 UTSW 5 138125208 missense probably benign 0.18
R1465:Zscan21 UTSW 5 138125208 missense probably benign 0.18
R1860:Zscan21 UTSW 5 138126630 missense probably benign 0.00
R5498:Zscan21 UTSW 5 138133260 missense probably benign
R5851:Zscan21 UTSW 5 138126478 missense probably benign 0.39
R6213:Zscan21 UTSW 5 138125097 missense probably benign 0.09
R7079:Zscan21 UTSW 5 138126466 missense probably benign 0.11
R7448:Zscan21 UTSW 5 138117848 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACCGGCCCTATGACTGTAAGTGTG -3'
(R):5'- GACGAGAATGGACCGTTACTGGAC -3'

Sequencing Primer
(F):5'- CCCTATGACTGTAAGTGTGGGAAAG -3'
(R):5'- tgatgcttggacagattggac -3'
Posted On2013-05-23