Incidental Mutation 'R5232:Prpf4b'
ID398637
Institutional Source Beutler Lab
Gene Symbol Prpf4b
Ensembl Gene ENSMUSG00000021413
Gene Namepre-mRNA processing factor 4B
SynonymsPrp4, Prp4k, Prpk
MMRRC Submission 042804-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5232 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location34875302-34906064 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 34883590 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000077853] [ENSMUST00000222509]
Predicted Effect unknown
Transcript: ENSMUST00000077853
AA Change: M134K
SMART Domains Protein: ENSMUSP00000077019
Gene: ENSMUSG00000021413
AA Change: M134K

DomainStartEndE-ValueType
low complexity region 40 62 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
coiled coil region 102 123 N/A INTRINSIC
low complexity region 142 150 N/A INTRINSIC
low complexity region 156 170 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
low complexity region 210 233 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
low complexity region 284 294 N/A INTRINSIC
low complexity region 299 324 N/A INTRINSIC
low complexity region 340 360 N/A INTRINSIC
low complexity region 390 417 N/A INTRINSIC
low complexity region 435 497 N/A INTRINSIC
low complexity region 521 535 N/A INTRINSIC
low complexity region 562 581 N/A INTRINSIC
S_TKc 687 1003 4.99e-74 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221639
Predicted Effect unknown
Transcript: ENSMUST00000222509
AA Change: M134K
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in two sequential transesterification steps, and the protein encoded by this gene is thought to be involved in pre-mRNA splicing and in signal transduction. This protein belongs to a kinase family that includes serine/arginine-rich protein-specific kinases and cyclin-dependent kinases (CDKs). This protein is regarded as a CDK-like kinase (Clk) with homology to mitogen-activated protein kinases (MAPKs). [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 T C 16: 20,338,922 E1295G probably damaging Het
Adarb2 C A 13: 8,713,640 H524Q possibly damaging Het
Arhgap26 A G 18: 38,993,476 M1V probably null Het
Atp10b G A 11: 43,202,179 R447H probably damaging Het
B4galnt3 T A 6: 120,232,988 Y58F probably damaging Het
Cdca7l A G 12: 117,870,085 E79G probably damaging Het
Chd4 C G 6: 125,121,310 P350A probably damaging Het
Coq2 G A 5: 100,657,832 H313Y possibly damaging Het
Cubn A T 2: 13,478,202 C244* probably null Het
Cyfip2 A G 11: 46,242,378 S832P probably damaging Het
Dnaaf1 A C 8: 119,590,590 E286A probably benign Het
Emilin1 A G 5: 30,916,979 K188R probably benign Het
Fstl5 T C 3: 76,144,977 W5R possibly damaging Het
Gm5565 T A 5: 146,160,137 Y64F possibly damaging Het
Golga4 G A 9: 118,506,558 probably null Het
Hmcn2 T C 2: 31,457,748 L4802P probably damaging Het
Hnrnpll C T 17: 80,038,678 V385I probably damaging Het
Kctd9 A T 14: 67,724,661 D51V probably damaging Het
Lcn9 T C 2: 25,824,055 probably null Het
Map1a C A 2: 121,301,985 P856H probably damaging Het
Myo5b G C 18: 74,714,932 E1080D probably damaging Het
Naglu T C 11: 101,070,150 I9T probably benign Het
Ndst3 A T 3: 123,672,239 I28N probably damaging Het
Olfm4 A G 14: 80,021,682 N424D probably damaging Het
Olfr722 A G 14: 49,895,698 Y35H probably damaging Het
Olfr742 T A 14: 50,516,038 V278E probably damaging Het
Phf13 T C 4: 151,992,223 T171A probably damaging Het
Plk3 A G 4: 117,129,120 V605A probably benign Het
Polr3a A T 14: 24,453,211 M1185K probably benign Het
Pramel7 A T 2: 87,489,976 H324Q probably damaging Het
Pxdn C T 12: 29,990,988 T421I probably benign Het
Sertad2 C T 11: 20,648,344 T180I possibly damaging Het
Sgo2b C A 8: 63,928,602 A399S possibly damaging Het
Skint5 T C 4: 113,577,644 K1043E unknown Het
Slc22a27 C G 19: 7,865,938 A359P probably damaging Het
Spock3 T C 8: 63,345,809 F288S probably damaging Het
Srgap1 T C 10: 121,840,911 I393V probably benign Het
Taf6 T C 5: 138,179,952 K429R possibly damaging Het
Vav1 T C 17: 57,303,846 F447L possibly damaging Het
Vmn2r19 T C 6: 123,335,957 M662T probably benign Het
Zfp541 A G 7: 16,095,179 Y1152C probably damaging Het
Other mutations in Prpf4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Prpf4b APN 13 34883907 missense probably benign 0.23
IGL00639:Prpf4b APN 13 34899173 missense possibly damaging 0.70
IGL00901:Prpf4b APN 13 34894482 missense probably damaging 1.00
IGL01301:Prpf4b APN 13 34884291 missense probably benign 0.23
IGL02027:Prpf4b APN 13 34889571 missense probably benign 0.35
IGL02111:Prpf4b APN 13 34883961 missense probably benign 0.23
IGL02256:Prpf4b APN 13 34899878 missense probably damaging 0.98
IGL02590:Prpf4b APN 13 34888146 unclassified probably benign
IGL03389:Prpf4b APN 13 34900456 splice site probably benign
IGL03411:Prpf4b APN 13 34895359 missense probably damaging 1.00
ANU18:Prpf4b UTSW 13 34884291 missense probably benign 0.23
PIT4260001:Prpf4b UTSW 13 34884291 missense probably benign 0.23
PIT4696001:Prpf4b UTSW 13 34899842 missense probably benign 0.01
R0114:Prpf4b UTSW 13 34890488 splice site probably benign
R0157:Prpf4b UTSW 13 34884031 unclassified probably benign
R1551:Prpf4b UTSW 13 34894443 missense possibly damaging 0.91
R1587:Prpf4b UTSW 13 34892150 missense probably benign 0.09
R2105:Prpf4b UTSW 13 34884231 unclassified probably benign
R2152:Prpf4b UTSW 13 34900419 missense probably benign 0.04
R2432:Prpf4b UTSW 13 34883341 unclassified probably benign
R3802:Prpf4b UTSW 13 34883682 unclassified probably benign
R3803:Prpf4b UTSW 13 34883682 unclassified probably benign
R3804:Prpf4b UTSW 13 34883682 unclassified probably benign
R3982:Prpf4b UTSW 13 34884213 unclassified probably benign
R4603:Prpf4b UTSW 13 34888164 unclassified probably benign
R4633:Prpf4b UTSW 13 34900442 missense probably damaging 1.00
R4649:Prpf4b UTSW 13 34899971 missense probably benign 0.06
R4651:Prpf4b UTSW 13 34899971 missense probably benign 0.06
R4653:Prpf4b UTSW 13 34899971 missense probably benign 0.06
R5022:Prpf4b UTSW 13 34883599 unclassified probably benign
R5028:Prpf4b UTSW 13 34899975 missense probably damaging 1.00
R5313:Prpf4b UTSW 13 34894549 missense probably damaging 1.00
R5440:Prpf4b UTSW 13 34884093 unclassified probably benign
R5511:Prpf4b UTSW 13 34884054 unclassified probably benign
R5863:Prpf4b UTSW 13 34899128 missense possibly damaging 0.51
R5981:Prpf4b UTSW 13 34886710 missense probably benign 0.23
R6360:Prpf4b UTSW 13 34901433 missense probably damaging 0.99
R6398:Prpf4b UTSW 13 34900371 missense probably damaging 1.00
R6556:Prpf4b UTSW 13 34896032 missense probably damaging 0.98
R6880:Prpf4b UTSW 13 34894453 missense possibly damaging 0.69
R7133:Prpf4b UTSW 13 34901494 missense probably benign 0.02
R7148:Prpf4b UTSW 13 34894472 missense probably benign 0.04
R7208:Prpf4b UTSW 13 34884011 missense unknown
Predicted Primers PCR Primer
(F):5'- GGAGAGGTATCAGAAGACCAATCTC -3'
(R):5'- AGCTTGGTCTTGAGACTTGC -3'

Sequencing Primer
(F):5'- ACATTCCTCAGAAGAAGATAGGG -3'
(R):5'- GTCCGATCTGTGCCTGGTC -3'
Posted On2016-07-06