Incidental Mutation 'R5248:Slc7a1'
ID398642
Institutional Source Beutler Lab
Gene Symbol Slc7a1
Ensembl Gene ENSMUSG00000041313
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 1
SynonymsRev-1, Rec-1, Atrc1, Cat1, mCAT-1, 4831426K01Rik, Atrc-1
MMRRC Submission 042819-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5248 (G1)
Quality Score147
Status Not validated
Chromosome5
Chromosomal Location148327410-148399904 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 148333988 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 556 (V556D)
Ref Sequence ENSEMBL: ENSMUSP00000046714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048116] [ENSMUST00000138257]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048116
AA Change: V556D

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000046714
Gene: ENSMUSG00000041313
AA Change: V556D

DomainStartEndE-ValueType
Pfam:AA_permease_2 32 440 1.3e-51 PFAM
Pfam:AA_permease 36 431 1.3e-42 PFAM
transmembrane domain 487 509 N/A INTRINSIC
transmembrane domain 519 541 N/A INTRINSIC
Pfam:AA_permease_C 551 601 1.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138257
SMART Domains Protein: ENSMUSP00000117781
Gene: ENSMUSG00000041313

DomainStartEndE-ValueType
Pfam:AA_permease_2 32 439 6e-52 PFAM
Pfam:AA_permease 36 433 2.3e-43 PFAM
transmembrane domain 487 509 N/A INTRINSIC
transmembrane domain 519 541 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutants die on the first day of birth and are very anemic. Peripheral blood contains 50% fewer red blood cells, reduced hemoglobin levels, and a defect in erythroid maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,109,438 E344D probably benign Het
Acoxl G A 2: 128,075,935 probably null Het
Adora1 A T 1: 134,203,486 L149Q possibly damaging Het
Aebp1 C A 11: 5,868,501 D115E possibly damaging Het
Ank3 A G 10: 69,987,108 I1819V probably benign Het
Ankrd44 T C 1: 54,667,380 H454R probably damaging Het
Ap4e1 C T 2: 127,064,922 A1034V possibly damaging Het
B3galt2 T A 1: 143,647,111 F328L probably benign Het
Bbip1 G A 19: 53,931,355 probably benign Het
Brsk1 G A 7: 4,708,866 E572K possibly damaging Het
Clca3a1 G T 3: 144,737,136 P716T possibly damaging Het
Clpx T C 9: 65,320,850 V380A probably damaging Het
Epha3 T A 16: 63,598,257 Q608H probably damaging Het
Gprc6a G T 10: 51,614,993 P712T probably damaging Het
Itpr1 C A 6: 108,542,062 Q2720K probably damaging Het
Kdm5b A G 1: 134,620,997 E1080G probably benign Het
Macf1 G A 4: 123,401,774 R3163* probably null Het
Map4k5 T C 12: 69,841,981 D292G probably benign Het
Mau2 A T 8: 70,028,723 C217S probably benign Het
Mtf1 T C 4: 124,820,427 F210L probably damaging Het
Mtif2 G A 11: 29,536,889 V300M probably damaging Het
Mtmr2 T C 9: 13,783,609 probably benign Het
Mybpc3 C A 2: 91,125,228 probably null Het
Ncmap T C 4: 135,380,119 probably null Het
Nek9 A G 12: 85,308,977 F672S probably damaging Het
Nuak1 A T 10: 84,409,678 I101N probably damaging Het
Olfr285 T C 15: 98,313,430 N40S probably damaging Het
Pcdh7 T A 5: 58,129,173 M1197K probably damaging Het
Pcdhb17 A C 18: 37,485,886 Q243P probably benign Het
Pcf11 T G 7: 92,661,491 K221Q probably damaging Het
Pkhd1 C T 1: 20,534,545 R1182H probably benign Het
Ptprz1 C A 6: 23,001,901 P1330Q probably benign Het
Rbm33 T G 5: 28,337,052 probably null Het
Rhobtb1 A G 10: 69,248,785 D2G probably damaging Het
Rngtt T A 4: 33,325,110 C110* probably null Het
Setx T A 2: 29,148,418 N1638K probably benign Het
Slc24a3 A T 2: 145,604,517 M282L probably benign Het
Sppl2c A T 11: 104,186,581 D69V possibly damaging Het
Srpk3 C T X: 73,774,949 R82* probably null Het
Tas2r120 A T 6: 132,657,147 N64I probably damaging Het
Tcf25 G T 8: 123,373,939 A23S probably damaging Het
Tigd2 A T 6: 59,211,153 K335I probably damaging Het
Tlr6 A G 5: 64,955,304 S87P probably benign Het
Tmem135 T A 7: 89,147,992 Y352F probably damaging Het
Tob2 T C 15: 81,851,717 Y17C probably damaging Het
Tymp GC GCC 15: 89,374,364 probably null Het
Vmn1r179 T C 7: 23,929,053 V223A probably damaging Het
Zfp946 T C 17: 22,454,466 V67A probably benign Het
Zswim4 G T 8: 84,219,932 N698K probably benign Het
Zzz3 A G 3: 152,427,545 Q80R probably damaging Het
Other mutations in Slc7a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01987:Slc7a1 APN 5 148337192 missense possibly damaging 0.61
H8441:Slc7a1 UTSW 5 148334545 missense probably benign 0.17
R0016:Slc7a1 UTSW 5 148334583 missense probably benign 0.04
R0028:Slc7a1 UTSW 5 148335511 missense probably benign 0.00
R0103:Slc7a1 UTSW 5 148352426 nonsense probably null
R0103:Slc7a1 UTSW 5 148352426 nonsense probably null
R0565:Slc7a1 UTSW 5 148352069 missense probably damaging 1.00
R0696:Slc7a1 UTSW 5 148340556 missense probably benign 0.11
R1338:Slc7a1 UTSW 5 148345936 missense probably damaging 1.00
R1539:Slc7a1 UTSW 5 148335593 missense possibly damaging 0.95
R1926:Slc7a1 UTSW 5 148348303 missense probably damaging 1.00
R2895:Slc7a1 UTSW 5 148340592 missense probably benign 0.06
R2910:Slc7a1 UTSW 5 148352257 missense probably benign 0.00
R3721:Slc7a1 UTSW 5 148335533 nonsense probably null
R3722:Slc7a1 UTSW 5 148335533 nonsense probably null
R4028:Slc7a1 UTSW 5 148345812 missense probably benign 0.01
R4114:Slc7a1 UTSW 5 148342057 missense probably damaging 1.00
R4510:Slc7a1 UTSW 5 148340562 missense probably damaging 1.00
R4511:Slc7a1 UTSW 5 148340562 missense probably damaging 1.00
R4600:Slc7a1 UTSW 5 148342059 missense probably damaging 1.00
R4657:Slc7a1 UTSW 5 148352399 missense probably benign
R4723:Slc7a1 UTSW 5 148335440 missense probably damaging 0.99
R5697:Slc7a1 UTSW 5 148333982 missense probably benign 0.00
R6027:Slc7a1 UTSW 5 148333964 missense possibly damaging 0.94
R6370:Slc7a1 UTSW 5 148340673 missense probably damaging 1.00
R6847:Slc7a1 UTSW 5 148334658 missense probably benign
R7007:Slc7a1 UTSW 5 148352446
V1024:Slc7a1 UTSW 5 148334545 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GCCTTACAGAGAGAAGCTGG -3'
(R):5'- GAGGTGACCCAAGGTATCTG -3'

Sequencing Primer
(F):5'- GGTATCGAATGCGGGTTCACC -3'
(R):5'- GGGGATAAAATGGATATCCCTC -3'
Posted On2016-07-06