Incidental Mutation 'R5232:Arhgap26'
List |< first << previous [record 89 of 1308] next >> last >|
ID398657
Institutional Source Beutler Lab
Gene Symbol Arhgap26
Ensembl Gene ENSMUSG00000036452
Gene NameRho GTPase activating protein 26
Synonyms2610010G17Rik, 1810044B20Rik, 4933432P15Rik
MMRRC Submission 042804-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R5232 (G1)
Quality Score151
Status Not validated
Chromosome18
Chromosomal Location38601534-39376284 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 38993476 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000122371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097593] [ENSMUST00000148850] [ENSMUST00000155576]
Predicted Effect probably null
Transcript: ENSMUST00000097593
AA Change: M1V

PolyPhen 2 Score 0.388 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000095200
Gene: ENSMUSG00000036452
AA Change: M1V

DomainStartEndE-ValueType
Pfam:BAR_3 6 249 1.8e-90 PFAM
Pfam:IMD 26 231 2.8e-9 PFAM
PH 266 371 3.23e-8 SMART
RhoGAP 387 565 4.51e-65 SMART
low complexity region 584 600 N/A INTRINSIC
low complexity region 617 652 N/A INTRINSIC
low complexity region 657 701 N/A INTRINSIC
SH3 759 814 5.11e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115574
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131421
Predicted Effect probably benign
Transcript: ENSMUST00000148850
SMART Domains Protein: ENSMUSP00000121894
Gene: ENSMUSG00000036452

DomainStartEndE-ValueType
coiled coil region 99 128 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000155576
AA Change: M1V

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122371
Gene: ENSMUSG00000036452
AA Change: M1V

DomainStartEndE-ValueType
Pfam:IMD 27 232 1.2e-8 PFAM
PH 266 371 3.23e-8 SMART
RhoGAP 387 565 4.51e-65 SMART
low complexity region 584 600 N/A INTRINSIC
low complexity region 617 652 N/A INTRINSIC
low complexity region 657 702 N/A INTRINSIC
SH3 704 759 5.11e-14 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interaction of a cell with the extracellular matrix triggers integrin cell surface receptors to begin signaling cascades that regulate the organization of the actin-cytoskeleton. One of the proteins involved in these cascades is focal adhesion kinase. The protein encoded by this gene is a GTPase activating protein that binds to focal adhesion kinase and mediates the activity of the GTP binding proteins RhoA and Cdc42. Defects in this gene are a cause of juvenile myelomonocytic leukemia (JMML). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous for a hypomorphic allele display reduced myofiber size, impaired myoblast fusion and abnormal muscle regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 T C 16: 20,338,922 E1295G probably damaging Het
Adarb2 C A 13: 8,713,640 H524Q possibly damaging Het
Atp10b G A 11: 43,202,179 R447H probably damaging Het
B4galnt3 T A 6: 120,232,988 Y58F probably damaging Het
Cdca7l A G 12: 117,870,085 E79G probably damaging Het
Chd4 C G 6: 125,121,310 P350A probably damaging Het
Coq2 G A 5: 100,657,832 H313Y possibly damaging Het
Cubn A T 2: 13,478,202 C244* probably null Het
Cyfip2 A G 11: 46,242,378 S832P probably damaging Het
Dnaaf1 A C 8: 119,590,590 E286A probably benign Het
Emilin1 A G 5: 30,916,979 K188R probably benign Het
Fstl5 T C 3: 76,144,977 W5R possibly damaging Het
Gm5565 T A 5: 146,160,137 Y64F possibly damaging Het
Golga4 G A 9: 118,506,558 probably null Het
Hmcn2 T C 2: 31,457,748 L4802P probably damaging Het
Hnrnpll C T 17: 80,038,678 V385I probably damaging Het
Kctd9 A T 14: 67,724,661 D51V probably damaging Het
Lcn9 T C 2: 25,824,055 probably null Het
Map1a C A 2: 121,301,985 P856H probably damaging Het
Myo5b G C 18: 74,714,932 E1080D probably damaging Het
Naglu T C 11: 101,070,150 I9T probably benign Het
Ndst3 A T 3: 123,672,239 I28N probably damaging Het
Olfm4 A G 14: 80,021,682 N424D probably damaging Het
Olfr722 A G 14: 49,895,698 Y35H probably damaging Het
Olfr742 T A 14: 50,516,038 V278E probably damaging Het
Phf13 T C 4: 151,992,223 T171A probably damaging Het
Plk3 A G 4: 117,129,120 V605A probably benign Het
Polr3a A T 14: 24,453,211 M1185K probably benign Het
Pramel7 A T 2: 87,489,976 H324Q probably damaging Het
Prpf4b T A 13: 34,883,590 probably benign Het
Pxdn C T 12: 29,990,988 T421I probably benign Het
Sertad2 C T 11: 20,648,344 T180I possibly damaging Het
Sgo2b C A 8: 63,928,602 A399S possibly damaging Het
Skint5 T C 4: 113,577,644 K1043E unknown Het
Slc22a27 C G 19: 7,865,938 A359P probably damaging Het
Spock3 T C 8: 63,345,809 F288S probably damaging Het
Srgap1 T C 10: 121,840,911 I393V probably benign Het
Taf6 T C 5: 138,179,952 K429R possibly damaging Het
Vav1 T C 17: 57,303,846 F447L possibly damaging Het
Vmn2r19 T C 6: 123,335,957 M662T probably benign Het
Zfp541 A G 7: 16,095,179 Y1152C probably damaging Het
Other mutations in Arhgap26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Arhgap26 APN 18 39286551 missense probably damaging 1.00
IGL01116:Arhgap26 APN 18 39111803 missense probably damaging 0.97
IGL01409:Arhgap26 APN 18 39110451 splice site probably benign
IGL02316:Arhgap26 APN 18 38642546
IGL02418:Arhgap26 APN 18 39357567 intron probably benign
IGL02588:Arhgap26 APN 18 38601617
IGL03241:Arhgap26 APN 18 39229917 missense probably damaging 1.00
R0184:Arhgap26 UTSW 18 38617673 missense unknown
R0244:Arhgap26 UTSW 18 39363131 missense probably benign 0.05
R0347:Arhgap26 UTSW 18 38617744 missense unknown
R1533:Arhgap26 UTSW 18 39371077 missense probably benign 0.16
R1606:Arhgap26 UTSW 18 39296872 missense probably damaging 1.00
R2066:Arhgap26 UTSW 18 39306728 missense probably damaging 1.00
R2182:Arhgap26 UTSW 18 39357809 intron probably benign
R2291:Arhgap26 UTSW 18 39357698 intron probably benign
R3611:Arhgap26 UTSW 18 38933919 missense probably benign
R3700:Arhgap26 UTSW 18 39120184 missense probably damaging 0.99
R3887:Arhgap26 UTSW 18 39229966 critical splice donor site probably null
R4621:Arhgap26 UTSW 18 38899841 intron probably benign
R4877:Arhgap26 UTSW 18 39296929 splice site probably null
R4910:Arhgap26 UTSW 18 38993637 splice site probably benign
R4911:Arhgap26 UTSW 18 38993637 splice site probably benign
R4954:Arhgap26 UTSW 18 39243641 missense probably benign 0.00
R4967:Arhgap26 UTSW 18 39246840 missense probably damaging 1.00
R5221:Arhgap26 UTSW 18 39110472 nonsense probably null
R5297:Arhgap26 UTSW 18 39121888 missense probably damaging 1.00
R5372:Arhgap26 UTSW 18 38642456 exon noncoding transcript
R5570:Arhgap26 UTSW 18 39099618 missense probably damaging 0.99
R5692:Arhgap26 UTSW 18 39121892 missense probably damaging 1.00
R5752:Arhgap26 UTSW 18 39286672 missense probably damaging 1.00
R5930:Arhgap26 UTSW 18 39150092 missense probably damaging 0.96
R6131:Arhgap26 UTSW 18 39286585 nonsense probably null
R6251:Arhgap26 UTSW 18 39357827 missense probably null
R6481:Arhgap26 UTSW 18 39150057 missense probably damaging 1.00
R6622:Arhgap26 UTSW 18 38899863 intron probably benign
R6799:Arhgap26 UTSW 18 39099607 missense probably damaging 1.00
R6878:Arhgap26 UTSW 18 39227412 missense probably damaging 1.00
R6989:Arhgap26 UTSW 18 39099629 missense probably damaging 1.00
X0013:Arhgap26 UTSW 18 39371112 missense probably damaging 1.00
X0025:Arhgap26 UTSW 18 39150105 missense probably damaging 1.00
Z1088:Arhgap26 UTSW 18 39357671 splice site probably benign
Predicted Primers PCR Primer
(F):5'- TAGGTCATCGCTAGCAGGTTC -3'
(R):5'- ATAGACACCGGTCACTCTGC -3'

Sequencing Primer
(F):5'- CTTCTGTGAGAGGGCGCTC -3'
(R):5'- GTCACTCTGCGCCCGAG -3'
Posted On2016-07-06