Incidental Mutation 'R5171:Gpsm1'
List |< first << previous [record 18 of 47] next >> last >|
ID398674
Institutional Source Beutler Lab
Gene Symbol Gpsm1
Ensembl Gene ENSMUSG00000026930
Gene NameG-protein signalling modulator 1 (AGS3-like, C. elegans)
SynonymsAgs3, 1810037C22Rik
MMRRC Submission 042751-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5171 (G1)
Quality Score144
Status Validated
Chromosome2
Chromosomal Location26315515-26348237 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 26327464 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000066889] [ENSMUST00000066936] [ENSMUST00000078616] [ENSMUST00000114134] [ENSMUST00000127453]
Predicted Effect probably benign
Transcript: ENSMUST00000066889
SMART Domains Protein: ENSMUSP00000067964
Gene: ENSMUSG00000026930

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
TPR 98 131 1.45e-1 SMART
TPR 138 171 7.06e-5 SMART
TPR 238 271 5.96e-3 SMART
TPR 278 311 1.47e-2 SMART
TPR 318 351 5.19e-3 SMART
TPR 358 391 1.33e0 SMART
GoLoco 525 547 7.38e-9 SMART
low complexity region 548 560 N/A INTRINSIC
GoLoco 578 600 4.24e-9 SMART
GoLoco 626 648 5.22e-9 SMART
GoLoco 660 682 3.58e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066936
SMART Domains Protein: ENSMUSP00000065000
Gene: ENSMUSG00000026930

DomainStartEndE-ValueType
TPR 66 99 1.45e-1 SMART
TPR 106 139 7.06e-5 SMART
TPR 206 239 5.96e-3 SMART
TPR 246 279 1.47e-2 SMART
TPR 286 319 5.19e-3 SMART
TPR 326 359 1.33e0 SMART
GoLoco 493 515 7.38e-9 SMART
low complexity region 516 528 N/A INTRINSIC
GoLoco 546 568 4.24e-9 SMART
GoLoco 594 616 5.22e-9 SMART
GoLoco 628 650 3.58e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078616
SMART Domains Protein: ENSMUSP00000077686
Gene: ENSMUSG00000026930

DomainStartEndE-ValueType
TPR 66 99 1.45e-1 SMART
TPR 106 139 7.06e-5 SMART
TPR 206 239 5.96e-3 SMART
TPR 246 279 1.47e-2 SMART
TPR 286 319 5.19e-3 SMART
TPR 326 359 1.33e0 SMART
GoLoco 433 455 7.38e-9 SMART
low complexity region 456 468 N/A INTRINSIC
GoLoco 486 508 4.24e-9 SMART
GoLoco 534 556 5.22e-9 SMART
GoLoco 568 590 3.58e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114134
SMART Domains Protein: ENSMUSP00000109769
Gene: ENSMUSG00000026930

DomainStartEndE-ValueType
GoLoco 56 78 7.38e-9 SMART
low complexity region 79 91 N/A INTRINSIC
GoLoco 109 131 4.24e-9 SMART
GoLoco 157 179 5.22e-9 SMART
GoLoco 191 213 3.58e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132638
Predicted Effect probably benign
Transcript: ENSMUST00000145884
SMART Domains Protein: ENSMUSP00000115680
Gene: ENSMUSG00000026930

DomainStartEndE-ValueType
Blast:TPR 22 68 1e-9 BLAST
Pfam:TPR_1 82 107 2.3e-4 PFAM
Pfam:TPR_12 82 147 7.9e-12 PFAM
Pfam:TPR_7 84 119 1.4e-5 PFAM
Pfam:TPR_2 122 147 6.2e-4 PFAM
Pfam:TPR_8 123 146 1.4e-2 PFAM
Blast:TPR 150 183 4e-15 BLAST
GoLoco 317 339 7.38e-9 SMART
low complexity region 340 352 N/A INTRINSIC
GoLoco 370 392 4.24e-9 SMART
GoLoco 418 440 5.22e-9 SMART
GoLoco 452 474 3.58e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153064
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] G-protein signaling modulators (GPSMs) play diverse functional roles through their interaction with G-protein subunits. This gene encodes a receptor-independent activator of G protein signaling, which is one of several factors that influence the basal activity of G-protein signaling systems. The protein contains seven tetratricopeptide repeats in its N-terminal half and four G-protein regulatory (GPR) motifs in its C-terminal half. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a lean phenotype, reduced fat mass, increased food consumption, increased nocturnal energy expenditure and altered blood pressure control mechanisms; surprisingly, their basal behavior and gross brain morphology remain normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C A 1: 130,742,847 Q269K probably benign Het
Acad9 T A 3: 36,074,398 I136N possibly damaging Het
Adtrp A G 13: 41,777,563 S183P probably damaging Het
Atp11b C T 3: 35,832,937 T690I probably damaging Het
Bcl2l12 G A 7: 44,991,394 probably benign Het
Btnl7-ps T A 17: 34,533,529 noncoding transcript Het
Ccl12 T C 11: 82,102,634 C33R probably damaging Het
Cdc25a T A 9: 109,877,161 S57R probably benign Het
Coro2a T A 4: 46,542,372 probably benign Het
Cpne6 T C 14: 55,512,148 V55A possibly damaging Het
Ddn A G 15: 98,806,326 S362P possibly damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Donson A G 16: 91,681,293 V258A possibly damaging Het
Gm3336 G A 8: 70,721,875 V163I probably benign Het
Gm8765 A T 13: 50,700,378 T91S possibly damaging Het
Gper1 C T 5: 139,426,658 R253C probably damaging Het
Hip1 A G 5: 135,440,302 S251P probably damaging Het
Ifi214 A G 1: 173,526,634 S157P possibly damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kntc1 T C 5: 123,799,844 V1535A probably benign Het
Mbd3l1 A G 9: 18,485,134 N185S probably benign Het
Mnx1 T C 5: 29,474,853 Q252R unknown Het
Mroh3 A T 1: 136,191,656 L463Q possibly damaging Het
Myom1 T C 17: 71,099,972 V1030A possibly damaging Het
Olfr1134 T G 2: 87,656,544 I126L possibly damaging Het
Olfr411 T C 11: 74,346,814 T257A probably benign Het
Olfr988 T C 2: 85,353,770 D52G probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Ranbp17 A G 11: 33,217,419 Y1015H probably benign Het
Rasal1 C T 5: 120,663,764 T256I probably benign Het
Rexo5 T A 7: 119,823,779 I278N probably damaging Het
Rims2 T A 15: 39,437,103 S77T probably damaging Het
Sdk2 C T 11: 113,850,982 A804T probably benign Het
Slc24a2 T A 4: 86,996,634 I589F probably benign Het
Slc25a38 T A 9: 120,122,115 I217K probably benign Het
Slc5a7 T C 17: 54,276,676 T529A probably benign Het
Spata22 T A 11: 73,336,208 S83T probably damaging Het
Stac2 A T 11: 98,043,498 C127S possibly damaging Het
Tep1 T C 14: 50,824,802 H2531R probably benign Het
Tmem151a G T 19: 5,082,033 R382S probably damaging Het
Trim60 T C 8: 65,000,524 T358A probably benign Het
Unc13c T A 9: 73,757,954 M1048L probably benign Het
Usp29 T C 7: 6,962,075 S306P probably damaging Het
Zfp26 T C 9: 20,444,907 K35R probably benign Het
Zfp462 T A 4: 55,016,986 probably null Het
Other mutations in Gpsm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01803:Gpsm1 APN 2 26346909 missense probably damaging 1.00
IGL01826:Gpsm1 APN 2 26326302 missense probably damaging 0.98
IGL02281:Gpsm1 APN 2 26339626 splice site probably benign
IGL02730:Gpsm1 APN 2 26325378 missense probably benign 0.13
IGL02740:Gpsm1 APN 2 26340573 missense probably benign 0.43
IGL02749:Gpsm1 APN 2 26339675 missense probably damaging 0.99
IGL02982:Gpsm1 APN 2 26324859 missense probably damaging 1.00
R1271:Gpsm1 UTSW 2 26344672 missense probably damaging 0.99
R1639:Gpsm1 UTSW 2 26345187 missense probably damaging 1.00
R1766:Gpsm1 UTSW 2 26325383 missense probably damaging 1.00
R1854:Gpsm1 UTSW 2 26344713 missense probably damaging 1.00
R2900:Gpsm1 UTSW 2 26345162 missense probably benign 0.00
R2994:Gpsm1 UTSW 2 26319831 unclassified probably benign
R2995:Gpsm1 UTSW 2 26319831 unclassified probably benign
R2996:Gpsm1 UTSW 2 26319831 unclassified probably benign
R4227:Gpsm1 UTSW 2 26339626 splice site probably benign
R4391:Gpsm1 UTSW 2 26323997 missense probably damaging 1.00
R4413:Gpsm1 UTSW 2 26319831 unclassified probably benign
R4461:Gpsm1 UTSW 2 26319831 unclassified probably benign
R4469:Gpsm1 UTSW 2 26319831 unclassified probably benign
R4659:Gpsm1 UTSW 2 26319831 unclassified probably benign
R4786:Gpsm1 UTSW 2 26322481 missense probably benign 0.01
R5025:Gpsm1 UTSW 2 26319996 missense possibly damaging 0.90
R5057:Gpsm1 UTSW 2 26325357 missense probably damaging 0.96
R5356:Gpsm1 UTSW 2 26340562 missense possibly damaging 0.73
R5417:Gpsm1 UTSW 2 26324033 critical splice donor site probably null
R5967:Gpsm1 UTSW 2 26340534 unclassified probably null
R6153:Gpsm1 UTSW 2 26325413 missense probably benign 0.14
R6969:Gpsm1 UTSW 2 26340543 missense probably benign 0.01
R7006:Gpsm1 UTSW 2 26322560 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGATCACAGTCCCAAGTCTGAC -3'
(R):5'- ATCAAGGACGAGTAGGTGCC -3'

Sequencing Primer
(F):5'- CTTGCTTCAGATTGGAGACCGAAAC -3'
(R):5'- ACGAGTAGGTGCCCAGATC -3'
Posted On2016-07-06