Incidental Mutation 'R5171:Olfr1134'
ID398678
Institutional Source Beutler Lab
Gene Symbol Olfr1134
Ensembl Gene ENSMUSG00000111747
Gene Name
SynonymsGA_x6K02T2Q125-49162076-49161138, MOR176-1
MMRRC Submission 042751-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R5171 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87655673-87658460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 87656544 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 126 (I126L)
Ref Sequence ENSEMBL: ENSMUSP00000150358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099857] [ENSMUST00000135875] [ENSMUST00000213939]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099854
AA Change: I126L

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097440
Gene: ENSMUSG00000075154
AA Change: I126L

DomainStartEndE-ValueType
GHB 123 190 1.21e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000099857
AA Change: I126L

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097443
Gene: ENSMUSG00000111747
AA Change: I126L

DomainStartEndE-ValueType
GHB 123 190 1.21e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000135875
AA Change: I126L

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000213939
AA Change: I126L

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.0548 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C A 1: 130,742,847 Q269K probably benign Het
Acad9 T A 3: 36,074,398 I136N possibly damaging Het
Adtrp A G 13: 41,777,563 S183P probably damaging Het
Atp11b C T 3: 35,832,937 T690I probably damaging Het
Bcl2l12 G A 7: 44,991,394 probably benign Het
Btnl7-ps T A 17: 34,533,529 noncoding transcript Het
Ccl12 T C 11: 82,102,634 C33R probably damaging Het
Cdc25a T A 9: 109,877,161 S57R probably benign Het
Coro2a T A 4: 46,542,372 probably benign Het
Cpne6 T C 14: 55,512,148 V55A possibly damaging Het
Ddn A G 15: 98,806,326 S362P possibly damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Donson A G 16: 91,681,293 V258A possibly damaging Het
Gm3336 G A 8: 70,721,875 V163I probably benign Het
Gm8765 A T 13: 50,700,378 T91S possibly damaging Het
Gper1 C T 5: 139,426,658 R253C probably damaging Het
Gpsm1 T A 2: 26,327,464 probably benign Het
Hip1 A G 5: 135,440,302 S251P probably damaging Het
Ifi214 A G 1: 173,526,634 S157P possibly damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kntc1 T C 5: 123,799,844 V1535A probably benign Het
Mbd3l1 A G 9: 18,485,134 N185S probably benign Het
Mnx1 T C 5: 29,474,853 Q252R unknown Het
Mroh3 A T 1: 136,191,656 L463Q possibly damaging Het
Myom1 T C 17: 71,099,972 V1030A possibly damaging Het
Olfr411 T C 11: 74,346,814 T257A probably benign Het
Olfr988 T C 2: 85,353,770 D52G probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Ranbp17 A G 11: 33,217,419 Y1015H probably benign Het
Rasal1 C T 5: 120,663,764 T256I probably benign Het
Rexo5 T A 7: 119,823,779 I278N probably damaging Het
Rims2 T A 15: 39,437,103 S77T probably damaging Het
Sdk2 C T 11: 113,850,982 A804T probably benign Het
Slc24a2 T A 4: 86,996,634 I589F probably benign Het
Slc25a38 T A 9: 120,122,115 I217K probably benign Het
Slc5a7 T C 17: 54,276,676 T529A probably benign Het
Spata22 T A 11: 73,336,208 S83T probably damaging Het
Stac2 A T 11: 98,043,498 C127S possibly damaging Het
Tep1 T C 14: 50,824,802 H2531R probably benign Het
Tmem151a G T 19: 5,082,033 R382S probably damaging Het
Trim60 T C 8: 65,000,524 T358A probably benign Het
Unc13c T A 9: 73,757,954 M1048L probably benign Het
Usp29 T C 7: 6,962,075 S306P probably damaging Het
Zfp26 T C 9: 20,444,907 K35R probably benign Het
Zfp462 T A 4: 55,016,986 probably null Het
Other mutations in Olfr1134
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Olfr1134 APN 2 87656238 missense probably benign 0.01
IGL01397:Olfr1134 APN 2 87656905 missense probably damaging 0.99
IGL01583:Olfr1134 APN 2 87656413 nonsense probably null
IGL01655:Olfr1134 APN 2 87656429 missense probably damaging 1.00
IGL02184:Olfr1134 APN 2 87656792 missense probably damaging 0.99
IGL02263:Olfr1134 APN 2 87656199 missense probably damaging 1.00
IGL02964:Olfr1134 APN 2 87656714 missense probably damaging 1.00
IGL03391:Olfr1134 APN 2 87656688 missense possibly damaging 0.93
R6434:Olfr1134 UTSW 2 87656214 nonsense probably null
R7466:Olfr1134 UTSW 2 87656396 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CAGTAAGGGTGGGATGTCAC -3'
(R):5'- AAACTGGACAGCAGGCTTC -3'

Sequencing Primer
(F):5'- TGTCACAGAAAAAGTGGTTGATGAC -3'
(R):5'- ATGTACTATTTCCTGAGCAACCTG -3'
Posted On2016-07-06