Incidental Mutation 'R5248:Mtif2'
ID398679
Institutional Source Beutler Lab
Gene Symbol Mtif2
Ensembl Gene ENSMUSG00000020459
Gene Namemitochondrial translational initiation factor 2
Synonyms2310038D14Rik, 2410112O06Rik, IF-2mt
MMRRC Submission 042819-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R5248 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location29526408-29545279 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 29536889 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 300 (V300M)
Ref Sequence ENSEMBL: ENSMUSP00000090926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020749] [ENSMUST00000093239] [ENSMUST00000133452] [ENSMUST00000136351] [ENSMUST00000144321]
Predicted Effect probably damaging
Transcript: ENSMUST00000020749
AA Change: V300M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020749
Gene: ENSMUSG00000020459
AA Change: V300M

DomainStartEndE-ValueType
Pfam:SRPRB 178 310 2.1e-6 PFAM
Pfam:GTP_EFTU 179 344 8.9e-34 PFAM
Pfam:MMR_HSR1 182 289 6.9e-10 PFAM
coiled coil region 449 484 N/A INTRINSIC
Pfam:IF-2 504 607 6.5e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000093239
AA Change: V300M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000090926
Gene: ENSMUSG00000020459
AA Change: V300M

DomainStartEndE-ValueType
Pfam:SRPRB 178 310 2.1e-6 PFAM
Pfam:GTP_EFTU 179 344 8.9e-34 PFAM
Pfam:MMR_HSR1 182 289 6.9e-10 PFAM
coiled coil region 449 484 N/A INTRINSIC
Pfam:IF-2 504 607 6.5e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129893
Predicted Effect unknown
Transcript: ENSMUST00000132783
AA Change: V109M
SMART Domains Protein: ENSMUSP00000121327
Gene: ENSMUSG00000020459
AA Change: V109M

DomainStartEndE-ValueType
PDB:3IZY|P 47 247 8e-92 PDB
SCOP:d1g7sa1 163 244 2e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133452
Predicted Effect probably benign
Transcript: ENSMUST00000136351
SMART Domains Protein: ENSMUSP00000122801
Gene: ENSMUSG00000020459

DomainStartEndE-ValueType
SCOP:d1f5na2 157 196 1e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000144321
AA Change: V300M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114299
Gene: ENSMUSG00000020459
AA Change: V300M

DomainStartEndE-ValueType
Pfam:Arf 175 341 1.1e-5 PFAM
Pfam:SRPRB 178 310 1.5e-6 PFAM
Pfam:GTP_EFTU 178 344 3.8e-39 PFAM
Pfam:MMR_HSR1 182 289 1.1e-8 PFAM
Pfam:Miro 182 291 1.2e-9 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] During the initiation of protein biosynthesis, initiation factor-2 (IF-2) promotes the binding of the initiator tRNA to the small subunit of the ribosome in a GTP-dependent manner. Prokaryotic IF-2 is a single polypeptide, while eukaryotic cytoplasmic IF-2 (eIF-2) is a trimeric protein. Bovine liver mitochondria contain IF-2(mt), an 85-kD monomeric protein that is equivalent to prokaryotic IF-2. The predicted 727-amino acid human protein contains a 29-amino acid presequence. Human IF-2(mt) shares 32 to 38% amino acid sequence identity with yeast IF-2(mt) and several prokaryotic IF-2s, with the greatest degree of conservation in the G domains of the proteins. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,109,438 E344D probably benign Het
Acoxl G A 2: 128,075,935 probably null Het
Adora1 A T 1: 134,203,486 L149Q possibly damaging Het
Aebp1 C A 11: 5,868,501 D115E possibly damaging Het
Ank3 A G 10: 69,987,108 I1819V probably benign Het
Ankrd44 T C 1: 54,667,380 H454R probably damaging Het
Ap4e1 C T 2: 127,064,922 A1034V possibly damaging Het
B3galt2 T A 1: 143,647,111 F328L probably benign Het
Bbip1 G A 19: 53,931,355 probably benign Het
Brsk1 G A 7: 4,708,866 E572K possibly damaging Het
Clca3a1 G T 3: 144,737,136 P716T possibly damaging Het
Clpx T C 9: 65,320,850 V380A probably damaging Het
Epha3 T A 16: 63,598,257 Q608H probably damaging Het
Gprc6a G T 10: 51,614,993 P712T probably damaging Het
Itpr1 C A 6: 108,542,062 Q2720K probably damaging Het
Kdm5b A G 1: 134,620,997 E1080G probably benign Het
Macf1 G A 4: 123,401,774 R3163* probably null Het
Map4k5 T C 12: 69,841,981 D292G probably benign Het
Mau2 A T 8: 70,028,723 C217S probably benign Het
Mtf1 T C 4: 124,820,427 F210L probably damaging Het
Mtmr2 T C 9: 13,783,609 probably benign Het
Mybpc3 C A 2: 91,125,228 probably null Het
Ncmap T C 4: 135,380,119 probably null Het
Nek9 A G 12: 85,308,977 F672S probably damaging Het
Nuak1 A T 10: 84,409,678 I101N probably damaging Het
Olfr285 T C 15: 98,313,430 N40S probably damaging Het
Pcdh7 T A 5: 58,129,173 M1197K probably damaging Het
Pcdhb17 A C 18: 37,485,886 Q243P probably benign Het
Pcf11 T G 7: 92,661,491 K221Q probably damaging Het
Pkhd1 C T 1: 20,534,545 R1182H probably benign Het
Ptprz1 C A 6: 23,001,901 P1330Q probably benign Het
Rbm33 T G 5: 28,337,052 probably null Het
Rhobtb1 A G 10: 69,248,785 D2G probably damaging Het
Rngtt T A 4: 33,325,110 C110* probably null Het
Setx T A 2: 29,148,418 N1638K probably benign Het
Slc24a3 A T 2: 145,604,517 M282L probably benign Het
Slc7a1 A T 5: 148,333,988 V556D possibly damaging Het
Sppl2c A T 11: 104,186,581 D69V possibly damaging Het
Srpk3 C T X: 73,774,949 R82* probably null Het
Tas2r120 A T 6: 132,657,147 N64I probably damaging Het
Tcf25 G T 8: 123,373,939 A23S probably damaging Het
Tigd2 A T 6: 59,211,153 K335I probably damaging Het
Tlr6 A G 5: 64,955,304 S87P probably benign Het
Tmem135 T A 7: 89,147,992 Y352F probably damaging Het
Tob2 T C 15: 81,851,717 Y17C probably damaging Het
Tymp GC GCC 15: 89,374,364 probably null Het
Vmn1r179 T C 7: 23,929,053 V223A probably damaging Het
Zfp946 T C 17: 22,454,466 V67A probably benign Het
Zswim4 G T 8: 84,219,932 N698K probably benign Het
Zzz3 A G 3: 152,427,545 Q80R probably damaging Het
Other mutations in Mtif2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Mtif2 APN 11 29538753 missense probably damaging 1.00
IGL01020:Mtif2 APN 11 29544973 missense possibly damaging 0.61
IGL01323:Mtif2 APN 11 29541447 missense probably damaging 0.98
IGL01360:Mtif2 APN 11 29530110 missense probably benign 0.00
IGL01744:Mtif2 APN 11 29544417 unclassified probably benign
IGL01757:Mtif2 APN 11 29541337 unclassified probably benign
IGL02247:Mtif2 APN 11 29540642 missense possibly damaging 0.65
IGL02642:Mtif2 APN 11 29544395 missense probably benign
IGL03093:Mtif2 APN 11 29530702 splice site probably benign
R0418:Mtif2 UTSW 11 29533401 splice site probably benign
R0554:Mtif2 UTSW 11 29533398 critical splice donor site probably null
R0577:Mtif2 UTSW 11 29540862 critical splice donor site probably null
R1159:Mtif2 UTSW 11 29540729 missense possibly damaging 0.95
R1168:Mtif2 UTSW 11 29536914 missense probably benign 0.11
R1344:Mtif2 UTSW 11 29545002 missense probably benign
R1418:Mtif2 UTSW 11 29545002 missense probably benign
R1482:Mtif2 UTSW 11 29536847 missense probably damaging 1.00
R1657:Mtif2 UTSW 11 29540721 missense probably benign 0.00
R1850:Mtif2 UTSW 11 29540683 missense probably benign 0.03
R3692:Mtif2 UTSW 11 29540718 missense probably benign 0.03
R4471:Mtif2 UTSW 11 29540053 splice site probably benign
R4730:Mtif2 UTSW 11 29540834 missense probably benign 0.00
R5343:Mtif2 UTSW 11 29536964 missense probably damaging 1.00
R5989:Mtif2 UTSW 11 29530098 missense probably damaging 0.96
R6511:Mtif2 UTSW 11 29536949 missense possibly damaging 0.81
X0064:Mtif2 UTSW 11 29538760 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GTAAGTCTAAAGTGGGTCTTTTCAGC -3'
(R):5'- GCTAGGACTACATAGAGAGACCTTG -3'

Sequencing Primer
(F):5'- TCTCACAGCGAATGTCTG -3'
(R):5'- GACCTTGTCTCAAACACAACAAC -3'
Posted On2016-07-06