Incidental Mutation 'R5171:Acad9'
ID398681
Institutional Source Beutler Lab
Gene Symbol Acad9
Ensembl Gene ENSMUSG00000027710
Gene Nameacyl-Coenzyme A dehydrogenase family, member 9
Synonyms2600017P15Rik, NPD002, C630012L17Rik
MMRRC Submission 042751-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.897) question?
Stock #R5171 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location36065979-36092853 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36074398 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 136 (I136N)
Ref Sequence ENSEMBL: ENSMUSP00000142557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011492] [ENSMUST00000196648] [ENSMUST00000197588]
Predicted Effect possibly damaging
Transcript: ENSMUST00000011492
AA Change: I136N

PolyPhen 2 Score 0.829 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000011492
Gene: ENSMUSG00000027710
AA Change: I136N

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
Pfam:Acyl-CoA_dh_N 69 177 1.2e-25 PFAM
Pfam:Acyl-CoA_dh_M 181 282 2e-27 PFAM
Pfam:Acyl-CoA_dh_1 294 445 9.6e-42 PFAM
Pfam:Acyl-CoA_dh_2 309 434 3.6e-12 PFAM
Blast:HisKA 448 550 1e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196535
Predicted Effect possibly damaging
Transcript: ENSMUST00000196648
AA Change: I136N

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142557
Gene: ENSMUSG00000027710
AA Change: I136N

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
Pfam:Acyl-CoA_dh_N 69 156 9.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197344
Predicted Effect probably benign
Transcript: ENSMUST00000197588
SMART Domains Protein: ENSMUSP00000142995
Gene: ENSMUSG00000027710

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_1 16 155 1.9e-37 PFAM
Pfam:Acyl-CoA_dh_2 31 156 8.4e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198987
Meta Mutation Damage Score 0.206 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-CoA dehydrogenase family. Members of this family of proteins localize to the mitochondria and catalyze the rate-limiting step in the beta-oxidation of fatty acyl-CoA. The encoded protein is specifically active toward palmitoyl-CoA and long-chain unsaturated substrates. Mutations in this gene cause acyl-CoA dehydrogenase family member type 9 deficiency. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C A 1: 130,742,847 Q269K probably benign Het
Adtrp A G 13: 41,777,563 S183P probably damaging Het
Atp11b C T 3: 35,832,937 T690I probably damaging Het
Bcl2l12 G A 7: 44,991,394 probably benign Het
Btnl7-ps T A 17: 34,533,529 noncoding transcript Het
Ccl12 T C 11: 82,102,634 C33R probably damaging Het
Cdc25a T A 9: 109,877,161 S57R probably benign Het
Coro2a T A 4: 46,542,372 probably benign Het
Cpne6 T C 14: 55,512,148 V55A possibly damaging Het
Ddn A G 15: 98,806,326 S362P possibly damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Donson A G 16: 91,681,293 V258A possibly damaging Het
Gm3336 G A 8: 70,721,875 V163I probably benign Het
Gm8765 A T 13: 50,700,378 T91S possibly damaging Het
Gper1 C T 5: 139,426,658 R253C probably damaging Het
Gpsm1 T A 2: 26,327,464 probably benign Het
Hip1 A G 5: 135,440,302 S251P probably damaging Het
Ifi214 A G 1: 173,526,634 S157P possibly damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kntc1 T C 5: 123,799,844 V1535A probably benign Het
Mbd3l1 A G 9: 18,485,134 N185S probably benign Het
Mnx1 T C 5: 29,474,853 Q252R unknown Het
Mroh3 A T 1: 136,191,656 L463Q possibly damaging Het
Myom1 T C 17: 71,099,972 V1030A possibly damaging Het
Olfr1134 T G 2: 87,656,544 I126L possibly damaging Het
Olfr411 T C 11: 74,346,814 T257A probably benign Het
Olfr988 T C 2: 85,353,770 D52G probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Ranbp17 A G 11: 33,217,419 Y1015H probably benign Het
Rasal1 C T 5: 120,663,764 T256I probably benign Het
Rexo5 T A 7: 119,823,779 I278N probably damaging Het
Rims2 T A 15: 39,437,103 S77T probably damaging Het
Sdk2 C T 11: 113,850,982 A804T probably benign Het
Slc24a2 T A 4: 86,996,634 I589F probably benign Het
Slc25a38 T A 9: 120,122,115 I217K probably benign Het
Slc5a7 T C 17: 54,276,676 T529A probably benign Het
Spata22 T A 11: 73,336,208 S83T probably damaging Het
Stac2 A T 11: 98,043,498 C127S possibly damaging Het
Tep1 T C 14: 50,824,802 H2531R probably benign Het
Tmem151a G T 19: 5,082,033 R382S probably damaging Het
Trim60 T C 8: 65,000,524 T358A probably benign Het
Unc13c T A 9: 73,757,954 M1048L probably benign Het
Usp29 T C 7: 6,962,075 S306P probably damaging Het
Zfp26 T C 9: 20,444,907 K35R probably benign Het
Zfp462 T A 4: 55,016,986 probably null Het
Other mutations in Acad9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Acad9 APN 3 36069762 missense probably benign 0.06
IGL01161:Acad9 APN 3 36090125 missense possibly damaging 0.93
IGL02016:Acad9 APN 3 36088486 critical splice acceptor site probably null
IGL02100:Acad9 APN 3 36081880 missense probably null 1.00
R0098:Acad9 UTSW 3 36073540 missense probably damaging 1.00
R0098:Acad9 UTSW 3 36073540 missense probably damaging 1.00
R0119:Acad9 UTSW 3 36085415 missense probably damaging 0.99
R0499:Acad9 UTSW 3 36085415 missense probably damaging 0.99
R1444:Acad9 UTSW 3 36078508 missense possibly damaging 0.80
R1564:Acad9 UTSW 3 36089429 missense possibly damaging 0.53
R2013:Acad9 UTSW 3 36073588 missense probably damaging 0.97
R2113:Acad9 UTSW 3 36074376 missense probably damaging 1.00
R2412:Acad9 UTSW 3 36073591 missense probably benign 0.26
R2428:Acad9 UTSW 3 36090923 missense probably benign
R4214:Acad9 UTSW 3 36073603 missense probably damaging 0.99
R4291:Acad9 UTSW 3 36066188 missense probably benign 0.14
R4562:Acad9 UTSW 3 36066182 missense probably benign 0.31
R4679:Acad9 UTSW 3 36088840 missense possibly damaging 0.79
R4758:Acad9 UTSW 3 36073605 missense probably damaging 1.00
R4953:Acad9 UTSW 3 36074376 missense probably damaging 1.00
R4970:Acad9 UTSW 3 36085525 missense probably damaging 1.00
R5137:Acad9 UTSW 3 36069771 missense probably benign 0.28
R5956:Acad9 UTSW 3 36075174 unclassified probably benign
R6285:Acad9 UTSW 3 36082175 missense probably benign 0.01
R6620:Acad9 UTSW 3 36066145 missense possibly damaging 0.93
R6880:Acad9 UTSW 3 36069705 splice site probably null
R6995:Acad9 UTSW 3 36085481 missense probably damaging 1.00
R7286:Acad9 UTSW 3 36075990 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTGACAGTTTCATTGTGCC -3'
(R):5'- GCTCAGGAAAGGATTCATTTCC -3'

Sequencing Primer
(F):5'- GACAGTTTCATTGTGCCATTCTG -3'
(R):5'- TCCAAAGATAGCACTAACCTTTGTC -3'
Posted On2016-07-06