Incidental Mutation 'R5248:Map4k5'
ID398686
Institutional Source Beutler Lab
Gene Symbol Map4k5
Ensembl Gene ENSMUSG00000034761
Gene Namemitogen-activated protein kinase kinase kinase kinase 5
SynonymsMAPKKKK5, GCKR, KHS, 4432415E19Rik
MMRRC Submission 042819-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5248 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location69803750-69893200 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69841981 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 292 (D292G)
Ref Sequence ENSEMBL: ENSMUSP00000106199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049239] [ENSMUST00000110567] [ENSMUST00000110570] [ENSMUST00000171211]
Predicted Effect probably benign
Transcript: ENSMUST00000049239
AA Change: D292G

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000047812
Gene: ENSMUSG00000034761
AA Change: D292G

DomainStartEndE-ValueType
S_TKc 20 277 4.07e-88 SMART
low complexity region 389 396 N/A INTRINSIC
low complexity region 471 482 N/A INTRINSIC
CNH 512 827 4.57e-142 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110567
AA Change: D292G

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106196
Gene: ENSMUSG00000034761
AA Change: D292G

DomainStartEndE-ValueType
S_TKc 20 277 4.07e-88 SMART
low complexity region 370 377 N/A INTRINSIC
low complexity region 452 463 N/A INTRINSIC
CNH 493 808 3.98e-142 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110570
AA Change: D292G

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106199
Gene: ENSMUSG00000034761
AA Change: D292G

DomainStartEndE-ValueType
S_TKc 20 277 4.07e-88 SMART
low complexity region 389 396 N/A INTRINSIC
low complexity region 471 482 N/A INTRINSIC
CNH 512 827 3.98e-142 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124715
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153712
Predicted Effect probably benign
Transcript: ENSMUST00000171211
AA Change: D225G

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000126006
Gene: ENSMUSG00000034761
AA Change: D225G

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 208 2e-32 PFAM
Pfam:Pkinase 1 210 6.2e-52 PFAM
low complexity region 322 329 N/A INTRINSIC
low complexity region 404 415 N/A INTRINSIC
CNH 445 760 4.57e-142 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188608
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family, that is highly similar to yeast SPS1/STE20 kinase. Yeast SPS1/STE20 functions near the beginning of the MAP kinase signal cascades that is essential for yeast pheromone response. This kinase was shown to activate Jun kinase in mammalian cells, which suggested a role in stress response. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are viable and phenotypically normal but show impaired canonical and noncanonical Wnt signaling in progenitor B lymphocytes. Mice homozygous for a gene trap exhibit hypoalgesia, increased serum IgG1 and an increased percentage of peripheral blood CD4+ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,109,438 E344D probably benign Het
Acoxl G A 2: 128,075,935 probably null Het
Adora1 A T 1: 134,203,486 L149Q possibly damaging Het
Aebp1 C A 11: 5,868,501 D115E possibly damaging Het
Ank3 A G 10: 69,987,108 I1819V probably benign Het
Ankrd44 T C 1: 54,667,380 H454R probably damaging Het
Ap4e1 C T 2: 127,064,922 A1034V possibly damaging Het
B3galt2 T A 1: 143,647,111 F328L probably benign Het
Bbip1 G A 19: 53,931,355 probably benign Het
Brsk1 G A 7: 4,708,866 E572K possibly damaging Het
Clca3a1 G T 3: 144,737,136 P716T possibly damaging Het
Clpx T C 9: 65,320,850 V380A probably damaging Het
Epha3 T A 16: 63,598,257 Q608H probably damaging Het
Gprc6a G T 10: 51,614,993 P712T probably damaging Het
Itpr1 C A 6: 108,542,062 Q2720K probably damaging Het
Kdm5b A G 1: 134,620,997 E1080G probably benign Het
Macf1 G A 4: 123,401,774 R3163* probably null Het
Mau2 A T 8: 70,028,723 C217S probably benign Het
Mtf1 T C 4: 124,820,427 F210L probably damaging Het
Mtif2 G A 11: 29,536,889 V300M probably damaging Het
Mtmr2 T C 9: 13,783,609 probably benign Het
Mybpc3 C A 2: 91,125,228 probably null Het
Ncmap T C 4: 135,380,119 probably null Het
Nek9 A G 12: 85,308,977 F672S probably damaging Het
Nuak1 A T 10: 84,409,678 I101N probably damaging Het
Olfr285 T C 15: 98,313,430 N40S probably damaging Het
Pcdh7 T A 5: 58,129,173 M1197K probably damaging Het
Pcdhb17 A C 18: 37,485,886 Q243P probably benign Het
Pcf11 T G 7: 92,661,491 K221Q probably damaging Het
Pkhd1 C T 1: 20,534,545 R1182H probably benign Het
Ptprz1 C A 6: 23,001,901 P1330Q probably benign Het
Rbm33 T G 5: 28,337,052 probably null Het
Rhobtb1 A G 10: 69,248,785 D2G probably damaging Het
Rngtt T A 4: 33,325,110 C110* probably null Het
Setx T A 2: 29,148,418 N1638K probably benign Het
Slc24a3 A T 2: 145,604,517 M282L probably benign Het
Slc7a1 A T 5: 148,333,988 V556D possibly damaging Het
Sppl2c A T 11: 104,186,581 D69V possibly damaging Het
Srpk3 C T X: 73,774,949 R82* probably null Het
Tas2r120 A T 6: 132,657,147 N64I probably damaging Het
Tcf25 G T 8: 123,373,939 A23S probably damaging Het
Tigd2 A T 6: 59,211,153 K335I probably damaging Het
Tlr6 A G 5: 64,955,304 S87P probably benign Het
Tmem135 T A 7: 89,147,992 Y352F probably damaging Het
Tob2 T C 15: 81,851,717 Y17C probably damaging Het
Tymp GC GCC 15: 89,374,364 probably null Het
Vmn1r179 T C 7: 23,929,053 V223A probably damaging Het
Zfp946 T C 17: 22,454,466 V67A probably benign Het
Zswim4 G T 8: 84,219,932 N698K probably benign Het
Zzz3 A G 3: 152,427,545 Q80R probably damaging Het
Other mutations in Map4k5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Map4k5 APN 12 69845732 missense probably damaging 1.00
IGL01013:Map4k5 APN 12 69827526 splice site probably benign
IGL01309:Map4k5 APN 12 69841963 missense probably benign 0.00
IGL02314:Map4k5 APN 12 69818439 missense probably benign 0.05
IGL02612:Map4k5 APN 12 69849584 missense possibly damaging 0.63
IGL02620:Map4k5 APN 12 69892702 missense probably benign 0.05
IGL02749:Map4k5 APN 12 69815806 missense probably benign 0.25
R0662:Map4k5 UTSW 12 69813153 missense probably damaging 1.00
R0731:Map4k5 UTSW 12 69874264 intron probably benign
R0828:Map4k5 UTSW 12 69805326 missense probably damaging 0.98
R1026:Map4k5 UTSW 12 69874288 missense possibly damaging 0.95
R1178:Map4k5 UTSW 12 69816378 missense probably damaging 0.99
R1464:Map4k5 UTSW 12 69805350 missense possibly damaging 0.89
R1464:Map4k5 UTSW 12 69805350 missense possibly damaging 0.89
R1615:Map4k5 UTSW 12 69844413 missense probably damaging 1.00
R1632:Map4k5 UTSW 12 69828047 missense probably benign
R1652:Map4k5 UTSW 12 69830427 critical splice donor site probably null
R1677:Map4k5 UTSW 12 69805308 missense probably benign 0.01
R1835:Map4k5 UTSW 12 69824662 missense probably damaging 1.00
R1895:Map4k5 UTSW 12 69845755 missense probably damaging 1.00
R1946:Map4k5 UTSW 12 69845755 missense probably damaging 1.00
R1968:Map4k5 UTSW 12 69818492 missense probably damaging 0.99
R1971:Map4k5 UTSW 12 69826328 missense possibly damaging 0.81
R1987:Map4k5 UTSW 12 69842912 missense probably damaging 1.00
R2070:Map4k5 UTSW 12 69816337 missense probably damaging 0.99
R2471:Map4k5 UTSW 12 69856846 missense probably benign 0.30
R3417:Map4k5 UTSW 12 69809264 missense probably damaging 1.00
R4133:Map4k5 UTSW 12 69845723 missense probably damaging 1.00
R4331:Map4k5 UTSW 12 69827374 missense probably benign 0.00
R4388:Map4k5 UTSW 12 69845809 missense probably damaging 1.00
R4685:Map4k5 UTSW 12 69811366 missense probably benign
R4760:Map4k5 UTSW 12 69824598 missense possibly damaging 0.49
R4822:Map4k5 UTSW 12 69841984 nonsense probably null
R4863:Map4k5 UTSW 12 69818438 missense probably benign 0.04
R4971:Map4k5 UTSW 12 69852719 missense possibly damaging 0.60
R5038:Map4k5 UTSW 12 69824614 missense probably damaging 1.00
R5055:Map4k5 UTSW 12 69831558 missense probably benign
R5428:Map4k5 UTSW 12 69838013 missense possibly damaging 0.94
R5697:Map4k5 UTSW 12 69830436 missense probably benign
R5757:Map4k5 UTSW 12 69824655 missense probably damaging 1.00
R5955:Map4k5 UTSW 12 69844390 missense probably damaging 1.00
R6258:Map4k5 UTSW 12 69831562 missense probably benign 0.06
R6259:Map4k5 UTSW 12 69852740 missense probably damaging 0.97
R6260:Map4k5 UTSW 12 69831562 missense probably benign 0.06
R6796:Map4k5 UTSW 12 69818025 missense probably benign 0.01
R6979:Map4k5 UTSW 12 69822848 missense probably damaging 1.00
R7164:Map4k5 UTSW 12 69830436 missense probably benign
R7184:Map4k5 UTSW 12 69874321 missense probably benign 0.00
X0062:Map4k5 UTSW 12 69824607 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGGAGTAGGAAAGCCTTCG -3'
(R):5'- ATGTCTCAATGCAGACTCCC -3'

Sequencing Primer
(F):5'- TATTGATCCAGGCCAAGCTG -3'
(R):5'- CCTGCTCATCTCTTCTTACAAGTTAC -3'
Posted On2016-07-06