Incidental Mutation 'R5171:Coro2a'
List |< first << previous [record 9 of 47] next >> last >|
ID398687
Institutional Source Beutler Lab
Gene Symbol Coro2a
Ensembl Gene ENSMUSG00000028337
Gene Namecoronin, actin binding protein 2A
Synonymscoronin 4, IR10, 9030208C03Rik
MMRRC Submission 042751-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R5171 (G1)
Quality Score202
Status Validated
Chromosome4
Chromosomal Location46536937-46602202 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 46542372 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030021] [ENSMUST00000107756] [ENSMUST00000107757]
Predicted Effect probably benign
Transcript: ENSMUST00000030021
SMART Domains Protein: ENSMUSP00000030021
Gene: ENSMUSG00000028337

DomainStartEndE-ValueType
DUF1899 5 69 3.93e-33 SMART
WD40 68 111 2.04e-5 SMART
WD40 121 161 1.58e-2 SMART
WD40 169 208 2.55e-6 SMART
DUF1900 261 397 9.15e-84 SMART
coiled coil region 488 521 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107756
SMART Domains Protein: ENSMUSP00000103385
Gene: ENSMUSG00000028337

DomainStartEndE-ValueType
DUF1899 5 69 3.93e-33 SMART
WD40 68 111 2.04e-5 SMART
WD40 121 161 1.58e-2 SMART
WD40 169 208 2.55e-6 SMART
DUF1900 261 397 9.15e-84 SMART
coiled coil region 488 521 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107757
SMART Domains Protein: ENSMUSP00000103386
Gene: ENSMUSG00000028337

DomainStartEndE-ValueType
DUF1899 24 88 3.93e-33 SMART
WD40 87 130 2.04e-5 SMART
WD40 140 180 1.58e-2 SMART
WD40 188 227 2.55e-6 SMART
DUF1900 280 416 9.15e-84 SMART
coiled coil region 507 540 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129121
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139179
Meta Mutation Damage Score 0.1148 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 5 WD repeats, and has a structural similarity with actin-binding proteins: the D. discoideum coronin and the human p57 protein, suggesting that this protein may also be an actin-binding protein that regulates cell motility. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C A 1: 130,742,847 Q269K probably benign Het
Acad9 T A 3: 36,074,398 I136N possibly damaging Het
Adtrp A G 13: 41,777,563 S183P probably damaging Het
Atp11b C T 3: 35,832,937 T690I probably damaging Het
Bcl2l12 G A 7: 44,991,394 probably benign Het
Btnl7-ps T A 17: 34,533,529 noncoding transcript Het
Ccl12 T C 11: 82,102,634 C33R probably damaging Het
Cdc25a T A 9: 109,877,161 S57R probably benign Het
Cpne6 T C 14: 55,512,148 V55A possibly damaging Het
Ddn A G 15: 98,806,326 S362P possibly damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Donson A G 16: 91,681,293 V258A possibly damaging Het
Gm3336 G A 8: 70,721,875 V163I probably benign Het
Gm8765 A T 13: 50,700,378 T91S possibly damaging Het
Gper1 C T 5: 139,426,658 R253C probably damaging Het
Gpsm1 T A 2: 26,327,464 probably benign Het
Hip1 A G 5: 135,440,302 S251P probably damaging Het
Ifi214 A G 1: 173,526,634 S157P possibly damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kntc1 T C 5: 123,799,844 V1535A probably benign Het
Mbd3l1 A G 9: 18,485,134 N185S probably benign Het
Mnx1 T C 5: 29,474,853 Q252R unknown Het
Mroh3 A T 1: 136,191,656 L463Q possibly damaging Het
Myom1 T C 17: 71,099,972 V1030A possibly damaging Het
Olfr1134 T G 2: 87,656,544 I126L possibly damaging Het
Olfr411 T C 11: 74,346,814 T257A probably benign Het
Olfr988 T C 2: 85,353,770 D52G probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Ranbp17 A G 11: 33,217,419 Y1015H probably benign Het
Rasal1 C T 5: 120,663,764 T256I probably benign Het
Rexo5 T A 7: 119,823,779 I278N probably damaging Het
Rims2 T A 15: 39,437,103 S77T probably damaging Het
Sdk2 C T 11: 113,850,982 A804T probably benign Het
Slc24a2 T A 4: 86,996,634 I589F probably benign Het
Slc25a38 T A 9: 120,122,115 I217K probably benign Het
Slc5a7 T C 17: 54,276,676 T529A probably benign Het
Spata22 T A 11: 73,336,208 S83T probably damaging Het
Stac2 A T 11: 98,043,498 C127S possibly damaging Het
Tep1 T C 14: 50,824,802 H2531R probably benign Het
Tmem151a G T 19: 5,082,033 R382S probably damaging Het
Trim60 T C 8: 65,000,524 T358A probably benign Het
Unc13c T A 9: 73,757,954 M1048L probably benign Het
Usp29 T C 7: 6,962,075 S306P probably damaging Het
Zfp26 T C 9: 20,444,907 K35R probably benign Het
Zfp462 T A 4: 55,016,986 probably null Het
Other mutations in Coro2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Coro2a APN 4 46540455 missense probably benign 0.06
IGL03093:Coro2a APN 4 46544158 missense possibly damaging 0.93
R1562:Coro2a UTSW 4 46548917 missense probably benign 0.02
R1862:Coro2a UTSW 4 46548797 missense possibly damaging 0.93
R1931:Coro2a UTSW 4 46539138 makesense probably null
R4385:Coro2a UTSW 4 46541961 missense possibly damaging 0.93
R5243:Coro2a UTSW 4 46545620 missense probably damaging 1.00
R5393:Coro2a UTSW 4 46542255 missense probably damaging 1.00
R5785:Coro2a UTSW 4 46564691 missense probably benign 0.03
R6014:Coro2a UTSW 4 46542261 missense probably damaging 1.00
R6184:Coro2a UTSW 4 46540504 missense probably benign
R6264:Coro2a UTSW 4 46562912 missense probably damaging 1.00
R6601:Coro2a UTSW 4 46543421 nonsense probably null
R6732:Coro2a UTSW 4 46551374 missense probably damaging 0.99
R6760:Coro2a UTSW 4 46540572 missense probably benign
R7499:Coro2a UTSW 4 46539188 missense not run
R7516:Coro2a UTSW 4 46562992 missense not run
R7567:Coro2a UTSW 4 46546674 missense not run
Predicted Primers PCR Primer
(F):5'- ACAGTGAGGACTAGGCCTTG -3'
(R):5'- GGAATCCTGCTTTGTTCCCTGG -3'

Sequencing Primer
(F):5'- AGGACTAGGCCTTGGAGTCTCTC -3'
(R):5'- CTGATCATAGGTGTGCAG -3'
Posted On2016-07-06