Incidental Mutation 'R5248:Olfr285'
ID398696
Institutional Source Beutler Lab
Gene Symbol Olfr285
Ensembl Gene ENSMUSG00000062037
Gene Nameolfactory receptor 285
SynonymsMOR160-3, GA_x6K02T2NBG7-5440777-5441736
MMRRC Submission 042819-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.042) question?
Stock #R5248 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location98309203-98317353 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98313430 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 40 (N40S)
Ref Sequence ENSEMBL: ENSMUSP00000150788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079736] [ENSMUST00000216901]
Predicted Effect probably damaging
Transcript: ENSMUST00000079736
AA Change: N40S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078672
Gene: ENSMUSG00000062037
AA Change: N40S

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 9.3e-47 PFAM
Pfam:7tm_1 39 286 5.9e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216901
AA Change: N40S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,109,438 E344D probably benign Het
Acoxl G A 2: 128,075,935 probably null Het
Adora1 A T 1: 134,203,486 L149Q possibly damaging Het
Aebp1 C A 11: 5,868,501 D115E possibly damaging Het
Ank3 A G 10: 69,987,108 I1819V probably benign Het
Ankrd44 T C 1: 54,667,380 H454R probably damaging Het
Ap4e1 C T 2: 127,064,922 A1034V possibly damaging Het
B3galt2 T A 1: 143,647,111 F328L probably benign Het
Bbip1 G A 19: 53,931,355 probably benign Het
Brsk1 G A 7: 4,708,866 E572K possibly damaging Het
Clca3a1 G T 3: 144,737,136 P716T possibly damaging Het
Clpx T C 9: 65,320,850 V380A probably damaging Het
Epha3 T A 16: 63,598,257 Q608H probably damaging Het
Gprc6a G T 10: 51,614,993 P712T probably damaging Het
Itpr1 C A 6: 108,542,062 Q2720K probably damaging Het
Kdm5b A G 1: 134,620,997 E1080G probably benign Het
Macf1 G A 4: 123,401,774 R3163* probably null Het
Map4k5 T C 12: 69,841,981 D292G probably benign Het
Mau2 A T 8: 70,028,723 C217S probably benign Het
Mtf1 T C 4: 124,820,427 F210L probably damaging Het
Mtif2 G A 11: 29,536,889 V300M probably damaging Het
Mtmr2 T C 9: 13,783,609 probably benign Het
Mybpc3 C A 2: 91,125,228 probably null Het
Ncmap T C 4: 135,380,119 probably null Het
Nek9 A G 12: 85,308,977 F672S probably damaging Het
Nuak1 A T 10: 84,409,678 I101N probably damaging Het
Pcdh7 T A 5: 58,129,173 M1197K probably damaging Het
Pcdhb17 A C 18: 37,485,886 Q243P probably benign Het
Pcf11 T G 7: 92,661,491 K221Q probably damaging Het
Pkhd1 C T 1: 20,534,545 R1182H probably benign Het
Ptprz1 C A 6: 23,001,901 P1330Q probably benign Het
Rbm33 T G 5: 28,337,052 probably null Het
Rhobtb1 A G 10: 69,248,785 D2G probably damaging Het
Rngtt T A 4: 33,325,110 C110* probably null Het
Setx T A 2: 29,148,418 N1638K probably benign Het
Slc24a3 A T 2: 145,604,517 M282L probably benign Het
Slc7a1 A T 5: 148,333,988 V556D possibly damaging Het
Sppl2c A T 11: 104,186,581 D69V possibly damaging Het
Srpk3 C T X: 73,774,949 R82* probably null Het
Tas2r120 A T 6: 132,657,147 N64I probably damaging Het
Tcf25 G T 8: 123,373,939 A23S probably damaging Het
Tigd2 A T 6: 59,211,153 K335I probably damaging Het
Tlr6 A G 5: 64,955,304 S87P probably benign Het
Tmem135 T A 7: 89,147,992 Y352F probably damaging Het
Tob2 T C 15: 81,851,717 Y17C probably damaging Het
Tymp GC GCC 15: 89,374,364 probably null Het
Vmn1r179 T C 7: 23,929,053 V223A probably damaging Het
Zfp946 T C 17: 22,454,466 V67A probably benign Het
Zswim4 G T 8: 84,219,932 N698K probably benign Het
Zzz3 A G 3: 152,427,545 Q80R probably damaging Het
Other mutations in Olfr285
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01986:Olfr285 APN 15 98312779 missense probably damaging 0.99
IGL02658:Olfr285 APN 15 98313356 missense probably damaging 1.00
R1423:Olfr285 UTSW 15 98313443 missense probably damaging 0.99
R1442:Olfr285 UTSW 15 98313187 missense probably damaging 0.98
R1863:Olfr285 UTSW 15 98313491 missense probably benign 0.02
R1938:Olfr285 UTSW 15 98313380 missense probably damaging 1.00
R4815:Olfr285 UTSW 15 98312680 missense probably damaging 1.00
R5879:Olfr285 UTSW 15 98313488 missense probably benign 0.00
R6000:Olfr285 UTSW 15 98313436 missense probably benign 0.08
R6371:Olfr285 UTSW 15 98313338 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- GGTGGCAAATGGCTGCATAG -3'
(R):5'- TCATGTCTGGACCAACAGTG -3'

Sequencing Primer
(F):5'- TGCATAGCGGTCATAGGCCATG -3'
(R):5'- CAACAGTGGATGAAATTTGGATCCTG -3'
Posted On2016-07-06