Incidental Mutation 'R5171:Mnx1'
List |< first << previous [record 24 of 47] next >> last >|
ID398697
Institutional Source Beutler Lab
Gene Symbol Mnx1
Ensembl Gene ENSMUSG00000001566
Gene Namemotor neuron and pancreas homeobox 1
SynonymsHlxb9, HB9, MNR2
MMRRC Submission 042751-MU
Accession Numbers

Genbank: NM_019944; MGI: 109160

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5171 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location29473034-29478470 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29474853 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 252 (Q252R)
Ref Sequence ENSEMBL: ENSMUSP00000129503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001608] [ENSMUST00000165512]
Predicted Effect unknown
Transcript: ENSMUST00000001608
AA Change: Q252R
SMART Domains Protein: ENSMUSP00000001608
Gene: ENSMUSG00000001566
AA Change: Q252R

DomainStartEndE-ValueType
low complexity region 39 64 N/A INTRINSIC
low complexity region 90 158 N/A INTRINSIC
low complexity region 168 176 N/A INTRINSIC
HOX 241 303 1.39e-25 SMART
low complexity region 346 366 N/A INTRINSIC
low complexity region 380 392 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000165512
AA Change: Q252R
SMART Domains Protein: ENSMUSP00000129503
Gene: ENSMUSG00000001566
AA Change: Q252R

DomainStartEndE-ValueType
low complexity region 39 64 N/A INTRINSIC
low complexity region 90 158 N/A INTRINSIC
low complexity region 168 176 N/A INTRINSIC
HOX 241 303 1.39e-25 SMART
low complexity region 346 366 N/A INTRINSIC
low complexity region 380 392 N/A INTRINSIC
Meta Mutation Damage Score 0.468 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein, which contains a homeobox domain and is a transcription factor. Mutations in this gene result in Currarino syndrome, an autosomic dominant congenital malformation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice die at birth exhibiting pancreas dorsal lobe agenesis, small pancreatic islets, and aberrant beta-cell function and motor axon guidance. Mice homozygous for other reporter/null alleles show neonatal death, atelectasis, and impaired motor neuron and pancreas differentiation. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Targeted, other(5)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C A 1: 130,742,847 Q269K probably benign Het
Acad9 T A 3: 36,074,398 I136N possibly damaging Het
Adtrp A G 13: 41,777,563 S183P probably damaging Het
Atp11b C T 3: 35,832,937 T690I probably damaging Het
Bcl2l12 G A 7: 44,991,394 probably benign Het
Btnl7-ps T A 17: 34,533,529 noncoding transcript Het
Ccl12 T C 11: 82,102,634 C33R probably damaging Het
Cdc25a T A 9: 109,877,161 S57R probably benign Het
Coro2a T A 4: 46,542,372 probably benign Het
Cpne6 T C 14: 55,512,148 V55A possibly damaging Het
Ddn A G 15: 98,806,326 S362P possibly damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Donson A G 16: 91,681,293 V258A possibly damaging Het
Gm3336 G A 8: 70,721,875 V163I probably benign Het
Gm8765 A T 13: 50,700,378 T91S possibly damaging Het
Gper1 C T 5: 139,426,658 R253C probably damaging Het
Gpsm1 T A 2: 26,327,464 probably benign Het
Hip1 A G 5: 135,440,302 S251P probably damaging Het
Ifi214 A G 1: 173,526,634 S157P possibly damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kntc1 T C 5: 123,799,844 V1535A probably benign Het
Mbd3l1 A G 9: 18,485,134 N185S probably benign Het
Mroh3 A T 1: 136,191,656 L463Q possibly damaging Het
Myom1 T C 17: 71,099,972 V1030A possibly damaging Het
Olfr1134 T G 2: 87,656,544 I126L possibly damaging Het
Olfr411 T C 11: 74,346,814 T257A probably benign Het
Olfr988 T C 2: 85,353,770 D52G probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Ranbp17 A G 11: 33,217,419 Y1015H probably benign Het
Rasal1 C T 5: 120,663,764 T256I probably benign Het
Rexo5 T A 7: 119,823,779 I278N probably damaging Het
Rims2 T A 15: 39,437,103 S77T probably damaging Het
Sdk2 C T 11: 113,850,982 A804T probably benign Het
Slc24a2 T A 4: 86,996,634 I589F probably benign Het
Slc25a38 T A 9: 120,122,115 I217K probably benign Het
Slc5a7 T C 17: 54,276,676 T529A probably benign Het
Spata22 T A 11: 73,336,208 S83T probably damaging Het
Stac2 A T 11: 98,043,498 C127S possibly damaging Het
Tep1 T C 14: 50,824,802 H2531R probably benign Het
Tmem151a G T 19: 5,082,033 R382S probably damaging Het
Trim60 T C 8: 65,000,524 T358A probably benign Het
Unc13c T A 9: 73,757,954 M1048L probably benign Het
Usp29 T C 7: 6,962,075 S306P probably damaging Het
Zfp26 T C 9: 20,444,907 K35R probably benign Het
Zfp462 T A 4: 55,016,986 probably null Het
Other mutations in Mnx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01602:Mnx1 APN 5 29477593 missense unknown
IGL01605:Mnx1 APN 5 29477593 missense unknown
3370:Mnx1 UTSW 5 29474887 missense unknown
PIT4472001:Mnx1 UTSW 5 29474107 missense unknown
R1752:Mnx1 UTSW 5 29477729 missense unknown
R1785:Mnx1 UTSW 5 29474189 missense unknown
R1786:Mnx1 UTSW 5 29474189 missense unknown
R1854:Mnx1 UTSW 5 29477782 missense unknown
R1866:Mnx1 UTSW 5 29474045 missense unknown
R1893:Mnx1 UTSW 5 29477830 missense unknown
R1899:Mnx1 UTSW 5 29473957 missense unknown
R2131:Mnx1 UTSW 5 29474189 missense unknown
R4698:Mnx1 UTSW 5 29474059 missense unknown
R4713:Mnx1 UTSW 5 29478131 missense probably damaging 1.00
R6126:Mnx1 UTSW 5 29478112 missense possibly damaging 0.94
R7427:Mnx1 UTSW 5 29474213 missense unknown
Predicted Primers PCR Primer
(F):5'- CATCCTAGAACCTCACGCTG -3'
(R):5'- ATGTCTGAGATGTGGGCCATAG -3'

Sequencing Primer
(F):5'- TCCTAGAACCTCACGCTGAAAATC -3'
(R):5'- CCATAGGGAGTGGGCACTG -3'
Posted On2016-07-06