Incidental Mutation 'R5248:Zfp946'
ID398700
Institutional Source Beutler Lab
Gene Symbol Zfp946
Ensembl Gene ENSMUSG00000071266
Gene Namezinc finger protein 946
Synonyms
MMRRC Submission 042819-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R5248 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location22424222-22456689 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22454466 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 67 (V67A)
Ref Sequence ENSEMBL: ENSMUSP00000132940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088763] [ENSMUST00000120222] [ENSMUST00000167740]
Predicted Effect probably benign
Transcript: ENSMUST00000088763
AA Change: V67A

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000086141
Gene: ENSMUSG00000071266
AA Change: V67A

DomainStartEndE-ValueType
KRAB 13 71 4.49e-17 SMART
ZnF_C2H2 186 208 3.83e-2 SMART
ZnF_C2H2 242 264 1.6e-4 SMART
ZnF_C2H2 270 292 1.45e-2 SMART
ZnF_C2H2 298 320 5.99e-4 SMART
ZnF_C2H2 326 348 2.15e-5 SMART
ZnF_C2H2 354 376 2.4e-3 SMART
ZnF_C2H2 382 404 1.28e-3 SMART
ZnF_C2H2 410 432 2.09e-3 SMART
ZnF_C2H2 438 460 9.44e-2 SMART
ZnF_C2H2 466 488 3.44e-4 SMART
ZnF_C2H2 494 516 1.5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120222
AA Change: V67A

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113244
Gene: ENSMUSG00000071266
AA Change: V67A

DomainStartEndE-ValueType
KRAB 13 71 4.49e-17 SMART
ZnF_C2H2 186 208 3.83e-2 SMART
ZnF_C2H2 242 264 1.6e-4 SMART
ZnF_C2H2 270 292 1.45e-2 SMART
ZnF_C2H2 298 320 5.99e-4 SMART
ZnF_C2H2 326 348 2.15e-5 SMART
ZnF_C2H2 354 376 2.4e-3 SMART
ZnF_C2H2 382 404 1.28e-3 SMART
ZnF_C2H2 410 432 2.09e-3 SMART
ZnF_C2H2 438 460 9.44e-2 SMART
ZnF_C2H2 466 488 3.44e-4 SMART
ZnF_C2H2 494 516 1.5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167740
AA Change: V67A

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000132940
Gene: ENSMUSG00000071266
AA Change: V67A

DomainStartEndE-ValueType
KRAB 13 71 4.49e-17 SMART
ZnF_C2H2 186 208 3.83e-2 SMART
ZnF_C2H2 242 264 1.6e-4 SMART
ZnF_C2H2 270 292 1.45e-2 SMART
ZnF_C2H2 298 320 5.99e-4 SMART
ZnF_C2H2 326 348 2.15e-5 SMART
ZnF_C2H2 354 376 2.4e-3 SMART
ZnF_C2H2 382 404 1.28e-3 SMART
ZnF_C2H2 410 432 2.09e-3 SMART
ZnF_C2H2 438 460 9.44e-2 SMART
ZnF_C2H2 466 488 3.44e-4 SMART
ZnF_C2H2 494 516 1.5e-4 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,109,438 E344D probably benign Het
Acoxl G A 2: 128,075,935 probably null Het
Adora1 A T 1: 134,203,486 L149Q possibly damaging Het
Aebp1 C A 11: 5,868,501 D115E possibly damaging Het
Ank3 A G 10: 69,987,108 I1819V probably benign Het
Ankrd44 T C 1: 54,667,380 H454R probably damaging Het
Ap4e1 C T 2: 127,064,922 A1034V possibly damaging Het
B3galt2 T A 1: 143,647,111 F328L probably benign Het
Bbip1 G A 19: 53,931,355 probably benign Het
Brsk1 G A 7: 4,708,866 E572K possibly damaging Het
Clca3a1 G T 3: 144,737,136 P716T possibly damaging Het
Clpx T C 9: 65,320,850 V380A probably damaging Het
Epha3 T A 16: 63,598,257 Q608H probably damaging Het
Gprc6a G T 10: 51,614,993 P712T probably damaging Het
Itpr1 C A 6: 108,542,062 Q2720K probably damaging Het
Kdm5b A G 1: 134,620,997 E1080G probably benign Het
Macf1 G A 4: 123,401,774 R3163* probably null Het
Map4k5 T C 12: 69,841,981 D292G probably benign Het
Mau2 A T 8: 70,028,723 C217S probably benign Het
Mtf1 T C 4: 124,820,427 F210L probably damaging Het
Mtif2 G A 11: 29,536,889 V300M probably damaging Het
Mtmr2 T C 9: 13,783,609 probably benign Het
Mybpc3 C A 2: 91,125,228 probably null Het
Ncmap T C 4: 135,380,119 probably null Het
Nek9 A G 12: 85,308,977 F672S probably damaging Het
Nuak1 A T 10: 84,409,678 I101N probably damaging Het
Olfr285 T C 15: 98,313,430 N40S probably damaging Het
Pcdh7 T A 5: 58,129,173 M1197K probably damaging Het
Pcdhb17 A C 18: 37,485,886 Q243P probably benign Het
Pcf11 T G 7: 92,661,491 K221Q probably damaging Het
Pkhd1 C T 1: 20,534,545 R1182H probably benign Het
Ptprz1 C A 6: 23,001,901 P1330Q probably benign Het
Rbm33 T G 5: 28,337,052 probably null Het
Rhobtb1 A G 10: 69,248,785 D2G probably damaging Het
Rngtt T A 4: 33,325,110 C110* probably null Het
Setx T A 2: 29,148,418 N1638K probably benign Het
Slc24a3 A T 2: 145,604,517 M282L probably benign Het
Slc7a1 A T 5: 148,333,988 V556D possibly damaging Het
Sppl2c A T 11: 104,186,581 D69V possibly damaging Het
Srpk3 C T X: 73,774,949 R82* probably null Het
Tas2r120 A T 6: 132,657,147 N64I probably damaging Het
Tcf25 G T 8: 123,373,939 A23S probably damaging Het
Tigd2 A T 6: 59,211,153 K335I probably damaging Het
Tlr6 A G 5: 64,955,304 S87P probably benign Het
Tmem135 T A 7: 89,147,992 Y352F probably damaging Het
Tob2 T C 15: 81,851,717 Y17C probably damaging Het
Tymp GC GCC 15: 89,374,364 probably null Het
Vmn1r179 T C 7: 23,929,053 V223A probably damaging Het
Zswim4 G T 8: 84,219,932 N698K probably benign Het
Zzz3 A G 3: 152,427,545 Q80R probably damaging Het
Other mutations in Zfp946
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Zfp946 APN 17 22454662 missense possibly damaging 0.88
IGL01869:Zfp946 APN 17 22454703 missense probably benign 0.45
IGL02037:Zfp946 APN 17 22453488 missense probably damaging 1.00
IGL03111:Zfp946 APN 17 22454556 missense possibly damaging 0.76
R0324:Zfp946 UTSW 17 22454436 missense probably benign 0.41
R1252:Zfp946 UTSW 17 22453579 critical splice donor site probably null
R1733:Zfp946 UTSW 17 22453557 missense probably damaging 1.00
R1971:Zfp946 UTSW 17 22455425 missense probably damaging 1.00
R2064:Zfp946 UTSW 17 22455465 missense probably damaging 1.00
R2106:Zfp946 UTSW 17 22453485 missense probably benign 0.30
R2216:Zfp946 UTSW 17 22454716 missense possibly damaging 0.49
R3899:Zfp946 UTSW 17 22454550 missense probably benign 0.05
R3924:Zfp946 UTSW 17 22455701 missense probably benign 0.06
R4125:Zfp946 UTSW 17 22454567 nonsense probably null
R4493:Zfp946 UTSW 17 22451086 splice site probably null
R4694:Zfp946 UTSW 17 22455711 missense probably benign 0.16
R4924:Zfp946 UTSW 17 22455521 missense probably damaging 1.00
R4939:Zfp946 UTSW 17 22455437 missense probably damaging 1.00
R5020:Zfp946 UTSW 17 22455603 missense probably benign 0.03
R5547:Zfp946 UTSW 17 22454892 missense probably benign 0.00
R5551:Zfp946 UTSW 17 22455384 missense probably damaging 1.00
R5573:Zfp946 UTSW 17 22454695 nonsense probably null
R6048:Zfp946 UTSW 17 22454840 missense probably benign 0.03
R6080:Zfp946 UTSW 17 22455109 missense probably benign 0.00
R6198:Zfp946 UTSW 17 22454915 missense probably damaging 1.00
R6332:Zfp946 UTSW 17 22454538 missense probably damaging 1.00
R6766:Zfp946 UTSW 17 22455771 missense probably benign 0.01
R7132:Zfp946 UTSW 17 22454663 missense probably benign 0.41
X0065:Zfp946 UTSW 17 22455513 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCAGTCACCTATTCGCCCAG -3'
(R):5'- ACAAGGTTCTCTGATGTTTCCAGTTC -3'

Sequencing Primer
(F):5'- AGGTTCTACTGAGCATCCATG -3'
(R):5'- CTGATGTTTCCAGTTCTATGTCTG -3'
Posted On2016-07-06