Incidental Mutation 'R5171:Bcl2l12'
ID398713
Institutional Source Beutler Lab
Gene Symbol Bcl2l12
Ensembl Gene ENSMUSG00000003190
Gene NameBCL2-like 12 (proline rich)
Synonyms2810475P17Rik, Bcl-L12, Bcl2-L12, 5430429M05Rik
MMRRC Submission 042751-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5171 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44991222-44998712 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 44991394 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003290] [ENSMUST00000107843] [ENSMUST00000207370] [ENSMUST00000207443] [ENSMUST00000207755] [ENSMUST00000208829]
Predicted Effect probably benign
Transcript: ENSMUST00000003290
SMART Domains Protein: ENSMUSP00000003290
Gene: ENSMUSG00000003190

DomainStartEndE-ValueType
low complexity region 47 61 N/A INTRINSIC
low complexity region 123 139 N/A INTRINSIC
low complexity region 170 197 N/A INTRINSIC
SCOP:d1maz__ 227 243 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107843
SMART Domains Protein: ENSMUSP00000103474
Gene: ENSMUSG00000109324

DomainStartEndE-ValueType
Pfam:PRMT5 41 343 1.9e-8 PFAM
Pfam:MTS 78 162 1.1e-6 PFAM
Pfam:PrmA 79 181 1.3e-9 PFAM
Pfam:Methyltransf_31 86 226 4e-10 PFAM
Pfam:Methyltransf_18 88 192 6.2e-9 PFAM
Pfam:Methyltransf_11 93 192 1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128816
AA Change: S475F
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141011
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152595
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207213
Predicted Effect probably benign
Transcript: ENSMUST00000207370
Predicted Effect probably benign
Transcript: ENSMUST00000207443
Predicted Effect probably benign
Transcript: ENSMUST00000207755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208128
Predicted Effect probably benign
Transcript: ENSMUST00000208829
Meta Mutation Damage Score 0.0596 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins containing a Bcl-2 homology domain 2 (BH2). The encoded protein is an anti-apoptotic factor that acts as an inhibitor of caspases 3 and 7 in the cytoplasm. In the nucleus, it binds to the p53 tumor suppressor protein, preventing its association with target genes. Overexpression of this gene has been detected in a number of different cancers. There is a pseudogene for this gene on chromosome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C A 1: 130,742,847 Q269K probably benign Het
Acad9 T A 3: 36,074,398 I136N possibly damaging Het
Adtrp A G 13: 41,777,563 S183P probably damaging Het
Atp11b C T 3: 35,832,937 T690I probably damaging Het
Btnl7-ps T A 17: 34,533,529 noncoding transcript Het
Ccl12 T C 11: 82,102,634 C33R probably damaging Het
Cdc25a T A 9: 109,877,161 S57R probably benign Het
Coro2a T A 4: 46,542,372 probably benign Het
Cpne6 T C 14: 55,512,148 V55A possibly damaging Het
Ddn A G 15: 98,806,326 S362P possibly damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Donson A G 16: 91,681,293 V258A possibly damaging Het
Gm3336 G A 8: 70,721,875 V163I probably benign Het
Gm8765 A T 13: 50,700,378 T91S possibly damaging Het
Gper1 C T 5: 139,426,658 R253C probably damaging Het
Gpsm1 T A 2: 26,327,464 probably benign Het
Hip1 A G 5: 135,440,302 S251P probably damaging Het
Ifi214 A G 1: 173,526,634 S157P possibly damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kntc1 T C 5: 123,799,844 V1535A probably benign Het
Mbd3l1 A G 9: 18,485,134 N185S probably benign Het
Mnx1 T C 5: 29,474,853 Q252R unknown Het
Mroh3 A T 1: 136,191,656 L463Q possibly damaging Het
Myom1 T C 17: 71,099,972 V1030A possibly damaging Het
Olfr1134 T G 2: 87,656,544 I126L possibly damaging Het
Olfr411 T C 11: 74,346,814 T257A probably benign Het
Olfr988 T C 2: 85,353,770 D52G probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Ranbp17 A G 11: 33,217,419 Y1015H probably benign Het
Rasal1 C T 5: 120,663,764 T256I probably benign Het
Rexo5 T A 7: 119,823,779 I278N probably damaging Het
Rims2 T A 15: 39,437,103 S77T probably damaging Het
Sdk2 C T 11: 113,850,982 A804T probably benign Het
Slc24a2 T A 4: 86,996,634 I589F probably benign Het
Slc25a38 T A 9: 120,122,115 I217K probably benign Het
Slc5a7 T C 17: 54,276,676 T529A probably benign Het
Spata22 T A 11: 73,336,208 S83T probably damaging Het
Stac2 A T 11: 98,043,498 C127S possibly damaging Het
Tep1 T C 14: 50,824,802 H2531R probably benign Het
Tmem151a G T 19: 5,082,033 R382S probably damaging Het
Trim60 T C 8: 65,000,524 T358A probably benign Het
Unc13c T A 9: 73,757,954 M1048L probably benign Het
Usp29 T C 7: 6,962,075 S306P probably damaging Het
Zfp26 T C 9: 20,444,907 K35R probably benign Het
Zfp462 T A 4: 55,016,986 probably null Het
Other mutations in Bcl2l12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02475:Bcl2l12 APN 7 44996893 missense possibly damaging 0.46
IGL02675:Bcl2l12 APN 7 44991400 unclassified probably benign
R0684:Bcl2l12 UTSW 7 44996601 missense probably benign 0.09
R1548:Bcl2l12 UTSW 7 44992818 missense probably damaging 1.00
R4612:Bcl2l12 UTSW 7 44996585 missense probably damaging 1.00
R4995:Bcl2l12 UTSW 7 44994191 splice site probably null
R5910:Bcl2l12 UTSW 7 44996543 critical splice donor site probably null
R5918:Bcl2l12 UTSW 7 44991464 unclassified probably benign
R7112:Bcl2l12 UTSW 7 44996914 missense probably damaging 1.00
R7471:Bcl2l12 UTSW 7 44996553 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TTCGTGCATTCACTCCAGTG -3'
(R):5'- GCTTAACCTCCGTCCTTAGAG -3'

Sequencing Primer
(F):5'- GTGCATTCACTCCAGTGCAAATG -3'
(R):5'- TCCGTCCTTAGAGCAGGGAC -3'
Posted On2016-07-06