Incidental Mutation 'R5171:Slc25a38'
ID398726
Institutional Source Beutler Lab
Gene Symbol Slc25a38
Ensembl Gene ENSMUSG00000032519
Gene Namesolute carrier family 25, member 38
Synonyms
MMRRC Submission 042751-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R5171 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location120110374-120124504 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120122115 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 217 (I217K)
Ref Sequence ENSEMBL: ENSMUSP00000121747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035106] [ENSMUST00000135514] [ENSMUST00000144768] [ENSMUST00000150093]
Predicted Effect probably benign
Transcript: ENSMUST00000035106
AA Change: I238K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000035106
Gene: ENSMUSG00000032519
AA Change: I238K

DomainStartEndE-ValueType
Pfam:Mito_carr 44 139 4.1e-23 PFAM
Pfam:Mito_carr 139 229 2.5e-19 PFAM
Pfam:Mito_carr 237 326 4.8e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135514
AA Change: I217K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000121747
Gene: ENSMUSG00000032519
AA Change: I217K

DomainStartEndE-ValueType
Pfam:Mito_carr 22 118 2.8e-23 PFAM
Pfam:Mito_carr 118 208 1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137522
Predicted Effect probably benign
Transcript: ENSMUST00000144768
SMART Domains Protein: ENSMUSP00000121454
Gene: ENSMUSG00000032519

DomainStartEndE-ValueType
Pfam:Mito_carr 44 114 1.2e-16 PFAM
low complexity region 163 182 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150093
SMART Domains Protein: ENSMUSP00000123357
Gene: ENSMUSG00000032519

DomainStartEndE-ValueType
Pfam:Mito_carr 44 114 5.5e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154969
Meta Mutation Damage Score 0.1248 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the mitochondrial carrier family. The encoded protein is required during erythropoiesis and is important for the biosynthesis of heme. Mutations in this gene are the cause of autosomal congenital sideroblastic anemia.[provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C A 1: 130,742,847 Q269K probably benign Het
Acad9 T A 3: 36,074,398 I136N possibly damaging Het
Adtrp A G 13: 41,777,563 S183P probably damaging Het
Atp11b C T 3: 35,832,937 T690I probably damaging Het
Bcl2l12 G A 7: 44,991,394 probably benign Het
Btnl7-ps T A 17: 34,533,529 noncoding transcript Het
Ccl12 T C 11: 82,102,634 C33R probably damaging Het
Cdc25a T A 9: 109,877,161 S57R probably benign Het
Coro2a T A 4: 46,542,372 probably benign Het
Cpne6 T C 14: 55,512,148 V55A possibly damaging Het
Ddn A G 15: 98,806,326 S362P possibly damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Donson A G 16: 91,681,293 V258A possibly damaging Het
Gm3336 G A 8: 70,721,875 V163I probably benign Het
Gm8765 A T 13: 50,700,378 T91S possibly damaging Het
Gper1 C T 5: 139,426,658 R253C probably damaging Het
Gpsm1 T A 2: 26,327,464 probably benign Het
Hip1 A G 5: 135,440,302 S251P probably damaging Het
Ifi214 A G 1: 173,526,634 S157P possibly damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kntc1 T C 5: 123,799,844 V1535A probably benign Het
Mbd3l1 A G 9: 18,485,134 N185S probably benign Het
Mnx1 T C 5: 29,474,853 Q252R unknown Het
Mroh3 A T 1: 136,191,656 L463Q possibly damaging Het
Myom1 T C 17: 71,099,972 V1030A possibly damaging Het
Olfr1134 T G 2: 87,656,544 I126L possibly damaging Het
Olfr411 T C 11: 74,346,814 T257A probably benign Het
Olfr988 T C 2: 85,353,770 D52G probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Ranbp17 A G 11: 33,217,419 Y1015H probably benign Het
Rasal1 C T 5: 120,663,764 T256I probably benign Het
Rexo5 T A 7: 119,823,779 I278N probably damaging Het
Rims2 T A 15: 39,437,103 S77T probably damaging Het
Sdk2 C T 11: 113,850,982 A804T probably benign Het
Slc24a2 T A 4: 86,996,634 I589F probably benign Het
Slc5a7 T C 17: 54,276,676 T529A probably benign Het
Spata22 T A 11: 73,336,208 S83T probably damaging Het
Stac2 A T 11: 98,043,498 C127S possibly damaging Het
Tep1 T C 14: 50,824,802 H2531R probably benign Het
Tmem151a G T 19: 5,082,033 R382S probably damaging Het
Trim60 T C 8: 65,000,524 T358A probably benign Het
Unc13c T A 9: 73,757,954 M1048L probably benign Het
Usp29 T C 7: 6,962,075 S306P probably damaging Het
Zfp26 T C 9: 20,444,907 K35R probably benign Het
Zfp462 T A 4: 55,016,986 probably null Het
Other mutations in Slc25a38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Slc25a38 APN 9 120120307 nonsense probably null
IGL01012:Slc25a38 APN 9 120116494 splice site probably benign
IGL02084:Slc25a38 APN 9 120120446 splice site probably benign
IGL02203:Slc25a38 APN 9 120120812 missense probably damaging 1.00
IGL02281:Slc25a38 APN 9 120117532 missense probably damaging 1.00
R0482:Slc25a38 UTSW 9 120120833 missense probably benign 0.01
R0532:Slc25a38 UTSW 9 120120706 missense probably damaging 1.00
R0550:Slc25a38 UTSW 9 120123643 missense probably benign 0.00
R1523:Slc25a38 UTSW 9 120123703 missense possibly damaging 0.94
R4908:Slc25a38 UTSW 9 120120288 missense probably damaging 1.00
R5976:Slc25a38 UTSW 9 120116547 missense probably damaging 0.98
R6092:Slc25a38 UTSW 9 120116592 missense probably damaging 1.00
R7379:Slc25a38 UTSW 9 120120836 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACACCTGCATTGTTCCAGTC -3'
(R):5'- AGTTCTACCGTTCCCCAGTG -3'

Sequencing Primer
(F):5'- CATTGTTCCAGTCGGGTGC -3'
(R):5'- TACCGTTCCCCAGTGTGCAG -3'
Posted On2016-07-06