Incidental Mutation 'R5171:Ccl12'
ID398734
Institutional Source Beutler Lab
Gene Symbol Ccl12
Ensembl Gene ENSMUSG00000035352
Gene Namechemokine (C-C motif) ligand 12
SynonymsScya12, MCP-5
MMRRC Submission 042751-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5171 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location82101845-82103400 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82102634 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 33 (C33R)
Ref Sequence ENSEMBL: ENSMUSP00000000194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000194]
Predicted Effect probably damaging
Transcript: ENSMUST00000000194
AA Change: C33R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000194
Gene: ENSMUSG00000035352
AA Change: C33R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SCY 30 89 4.49e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124916
Meta Mutation Damage Score 0.2 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of several cytokine genes clustered on the q-arm of chromosome 17. Chemokines are a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of N-terminal cysteine residues of the mature peptide. This chemokine is a member of the CC subfamily which is characterized by two adjacent cysteine residues. This cytokine displays chemotactic activity for monocytes and basophils but not for neutrophils or eosinophils. It has been implicated in the pathogenesis of diseases characterized by monocytic infiltrates, like psoriasis, rheumatoid arthritis and atherosclerosis. It binds to chemokine receptors CCR2 and CCR4. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and developmentally normal with no apparent alterations in monocyte homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C A 1: 130,742,847 Q269K probably benign Het
Acad9 T A 3: 36,074,398 I136N possibly damaging Het
Adtrp A G 13: 41,777,563 S183P probably damaging Het
Atp11b C T 3: 35,832,937 T690I probably damaging Het
Bcl2l12 G A 7: 44,991,394 probably benign Het
Btnl7-ps T A 17: 34,533,529 noncoding transcript Het
Cdc25a T A 9: 109,877,161 S57R probably benign Het
Coro2a T A 4: 46,542,372 probably benign Het
Cpne6 T C 14: 55,512,148 V55A possibly damaging Het
Ddn A G 15: 98,806,326 S362P possibly damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Donson A G 16: 91,681,293 V258A possibly damaging Het
Gm3336 G A 8: 70,721,875 V163I probably benign Het
Gm8765 A T 13: 50,700,378 T91S possibly damaging Het
Gper1 C T 5: 139,426,658 R253C probably damaging Het
Gpsm1 T A 2: 26,327,464 probably benign Het
Hip1 A G 5: 135,440,302 S251P probably damaging Het
Ifi214 A G 1: 173,526,634 S157P possibly damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kntc1 T C 5: 123,799,844 V1535A probably benign Het
Mbd3l1 A G 9: 18,485,134 N185S probably benign Het
Mnx1 T C 5: 29,474,853 Q252R unknown Het
Mroh3 A T 1: 136,191,656 L463Q possibly damaging Het
Myom1 T C 17: 71,099,972 V1030A possibly damaging Het
Olfr1134 T G 2: 87,656,544 I126L possibly damaging Het
Olfr411 T C 11: 74,346,814 T257A probably benign Het
Olfr988 T C 2: 85,353,770 D52G probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Ranbp17 A G 11: 33,217,419 Y1015H probably benign Het
Rasal1 C T 5: 120,663,764 T256I probably benign Het
Rexo5 T A 7: 119,823,779 I278N probably damaging Het
Rims2 T A 15: 39,437,103 S77T probably damaging Het
Sdk2 C T 11: 113,850,982 A804T probably benign Het
Slc24a2 T A 4: 86,996,634 I589F probably benign Het
Slc25a38 T A 9: 120,122,115 I217K probably benign Het
Slc5a7 T C 17: 54,276,676 T529A probably benign Het
Spata22 T A 11: 73,336,208 S83T probably damaging Het
Stac2 A T 11: 98,043,498 C127S possibly damaging Het
Tep1 T C 14: 50,824,802 H2531R probably benign Het
Tmem151a G T 19: 5,082,033 R382S probably damaging Het
Trim60 T C 8: 65,000,524 T358A probably benign Het
Unc13c T A 9: 73,757,954 M1048L probably benign Het
Usp29 T C 7: 6,962,075 S306P probably damaging Het
Zfp26 T C 9: 20,444,907 K35R probably benign Het
Zfp462 T A 4: 55,016,986 probably null Het
Other mutations in Ccl12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01604:Ccl12 APN 11 82103233 makesense probably null
IGL02327:Ccl12 APN 11 82103122 missense possibly damaging 0.96
IGL02567:Ccl12 APN 11 82102621 missense possibly damaging 0.89
R2121:Ccl12 UTSW 11 82101950 missense probably damaging 1.00
R4924:Ccl12 UTSW 11 82102649 missense probably benign 0.02
R5435:Ccl12 UTSW 11 82103175 missense possibly damaging 0.51
R6188:Ccl12 UTSW 11 82103117 missense probably damaging 1.00
R6885:Ccl12 UTSW 11 82102697 missense probably damaging 0.96
X0024:Ccl12 UTSW 11 82103127 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCTGTGTCAGAAATTGATGGG -3'
(R):5'- GCTACATCTGTTTGACTTAAGACC -3'

Sequencing Primer
(F):5'- TGTCAGAAATTGATGGGATTTTTCC -3'
(R):5'- TTGACTTAAGACCATGAATCCAGAC -3'
Posted On2016-07-06