Incidental Mutation 'R5249:Arfgap2'
ID398735
Institutional Source Beutler Lab
Gene Symbol Arfgap2
Ensembl Gene ENSMUSG00000027255
Gene NameADP-ribosylation factor GTPase activating protein 2
Synonyms2310032E02Rik, Zfp289
MMRRC Submission 042820-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.731) question?
Stock #R5249 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location91264974-91276931 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 91265637 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 46 (C46*)
Ref Sequence ENSEMBL: ENSMUSP00000078920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028691] [ENSMUST00000028694] [ENSMUST00000059566] [ENSMUST00000080008] [ENSMUST00000111349] [ENSMUST00000131711] [ENSMUST00000134699] [ENSMUST00000138470] [ENSMUST00000144394] [ENSMUST00000156919] [ENSMUST00000168916]
Predicted Effect probably null
Transcript: ENSMUST00000028691
AA Change: C46*
SMART Domains Protein: ENSMUSP00000028691
Gene: ENSMUSG00000027255
AA Change: C46*

DomainStartEndE-ValueType
ArfGap 11 125 1.46e-44 SMART
low complexity region 227 246 N/A INTRINSIC
coiled coil region 254 321 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
Blast:ArfGap 370 434 6e-32 BLAST
low complexity region 468 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000028694
SMART Domains Protein: ENSMUSP00000028694
Gene: ENSMUSG00000027257

DomainStartEndE-ValueType
FCH 14 102 2.05e-21 SMART
low complexity region 337 349 N/A INTRINSIC
SH3 366 423 1.03e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059566
SMART Domains Protein: ENSMUSP00000054391
Gene: ENSMUSG00000027257

DomainStartEndE-ValueType
FCH 14 102 2.05e-21 SMART
low complexity region 337 349 N/A INTRINSIC
SH3 366 423 1.03e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000080008
AA Change: C46*
SMART Domains Protein: ENSMUSP00000078920
Gene: ENSMUSG00000027255
AA Change: C46*

DomainStartEndE-ValueType
ArfGap 11 125 1.46e-44 SMART
low complexity region 213 232 N/A INTRINSIC
coiled coil region 240 307 N/A INTRINSIC
low complexity region 309 321 N/A INTRINSIC
internal_repeat_1 333 376 9.77e-5 PROSPERO
low complexity region 454 462 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111349
SMART Domains Protein: ENSMUSP00000106981
Gene: ENSMUSG00000027257

DomainStartEndE-ValueType
FCH 14 102 2.05e-21 SMART
low complexity region 337 349 N/A INTRINSIC
SH3 366 423 1.03e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128296
Predicted Effect probably benign
Transcript: ENSMUST00000128684
SMART Domains Protein: ENSMUSP00000118915
Gene: ENSMUSG00000027257

DomainStartEndE-ValueType
PDB:3SYV|H 2 61 3e-37 PDB
low complexity region 62 74 N/A INTRINSIC
SCOP:d1k4us_ 86 112 6e-7 SMART
PDB:2X3X|E 88 112 7e-7 PDB
Blast:SH3 91 112 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000131711
SMART Domains Protein: ENSMUSP00000117214
Gene: ENSMUSG00000027257

DomainStartEndE-ValueType
FCH 14 102 2.05e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134699
SMART Domains Protein: ENSMUSP00000115046
Gene: ENSMUSG00000027257

DomainStartEndE-ValueType
FCH 14 102 2.05e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138470
SMART Domains Protein: ENSMUSP00000117230
Gene: ENSMUSG00000027257

DomainStartEndE-ValueType
FCH 14 102 2.05e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141313
Predicted Effect probably benign
Transcript: ENSMUST00000144394
SMART Domains Protein: ENSMUSP00000121297
Gene: ENSMUSG00000027257

DomainStartEndE-ValueType
FCH 14 95 4.88e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146228
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150701
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150753
Predicted Effect probably benign
Transcript: ENSMUST00000156919
SMART Domains Protein: ENSMUSP00000122779
Gene: ENSMUSG00000027257

DomainStartEndE-ValueType
FCH 14 102 2.05e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168916
SMART Domains Protein: ENSMUSP00000129175
Gene: ENSMUSG00000027257

DomainStartEndE-ValueType
FCH 14 102 2.05e-21 SMART
low complexity region 337 349 N/A INTRINSIC
SH3 366 423 1.03e-18 SMART
Meta Mutation Damage Score 0.6176 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: This gene encodes a zinc-finger-containing GTPase-activating protein for ADP ribosylation factor 1 (ARF1), a small GTPase that plays a role in coatomer-mediated vesicular trafficking. This gene product stimulates the hydrolysis of ARF1-bound GTP, which may lead to dissociation of coatomer from Golgi-derived membranes to allow fusion with target membranes. It may regulate the retrograde transport from the Golgi complex to the endoplasmic reticulum. Expression of this gene has been shown to be controlled by inhibitor of DNA binding 1 (Id1). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A pseudogene of this gene was identified on chromosome 6. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,575,483 *719Q probably null Het
2810403A07Rik T A 3: 88,696,725 I283N probably damaging Het
A4gnt A G 9: 99,620,231 H148R probably damaging Het
Acrbp A G 6: 125,060,922 D394G probably damaging Het
Adam18 T C 8: 24,625,852 T609A probably benign Het
Adam25 T A 8: 40,755,954 N752K probably benign Het
Ano6 A C 15: 95,913,588 S176R probably benign Het
Ano7 T C 1: 93,375,196 S19P probably benign Het
Ap1b1 A G 11: 5,026,364 E437G probably damaging Het
Arhgef26 T A 3: 62,340,560 L355Q probably damaging Het
B4galnt4 C T 7: 141,065,070 T219I probably damaging Het
Bap1 C T 14: 31,257,286 probably benign Het
Catip T G 1: 74,362,795 L43R probably damaging Het
Ccdc177 G A 12: 80,758,508 R331C unknown Het
Cep85l T C 10: 53,319,594 probably null Het
Cfap206 T A 4: 34,714,502 Q398L probably benign Het
Clec18a A G 8: 111,073,736 C352R probably damaging Het
Clic6 A T 16: 92,539,451 Y549F probably damaging Het
Cpne9 C T 6: 113,293,073 probably benign Het
Cyb5r3 A C 15: 83,158,635 probably benign Het
Dnah6 C T 6: 73,113,488 R2293K probably damaging Het
Dnmbp C A 19: 43,902,440 R296L probably damaging Het
Dtwd1 C A 2: 126,154,774 Q60K probably benign Het
Esyt1 C A 10: 128,516,574 V723L probably benign Het
Fam71f1 A G 6: 29,323,897 D207G probably damaging Het
Fbxo42 T C 4: 141,199,024 L339P probably damaging Het
Furin A T 7: 80,393,421 N347K probably damaging Het
Fzd7 T C 1: 59,483,363 M135T probably damaging Het
Hlf A G 11: 90,387,806 M144T probably benign Het
Hyal5 C T 6: 24,876,649 Q174* probably null Het
Kcnb1 T A 2: 167,105,183 M582L possibly damaging Het
Kdm5d T C Y: 916,692 Y391H probably damaging Het
Kif21b C T 1: 136,169,228 T1297M probably damaging Het
Krt8 T G 15: 101,998,440 N317T possibly damaging Het
Lctl G T 9: 64,137,914 V372L probably benign Het
Lig1 C T 7: 13,308,507 H822Y possibly damaging Het
Lrrc4b A G 7: 44,462,564 D620G possibly damaging Het
Mboat4 C T 8: 34,115,121 H10Y probably benign Het
Med1 A T 11: 98,157,240 M910K probably benign Het
Mia2 A T 12: 59,108,125 D209V probably damaging Het
Mpp4 C T 1: 59,144,858 probably benign Het
Mrgprb1 A T 7: 48,447,477 V229E possibly damaging Het
Mtor T A 4: 148,463,732 C485S probably damaging Het
Mx1 T C 16: 97,457,428 D23G probably damaging Het
Myrfl T C 10: 116,783,233 D740G probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nav2 G A 7: 49,535,913 V874I probably damaging Het
Ntrk3 A T 7: 78,461,166 N262K possibly damaging Het
Olfr819 C T 10: 129,966,209 A164T probably benign Het
Olfr916 A G 9: 38,658,078 C105R possibly damaging Het
Opa1 A T 16: 29,618,259 D699V probably damaging Het
Otud7a A G 7: 63,757,433 N495D possibly damaging Het
Pcsk9 T C 4: 106,463,753 D53G probably benign Het
Pdcd5 A G 7: 35,646,996 probably benign Het
Phf21a C T 2: 92,228,477 P28L probably damaging Het
Pitpnm1 T A 19: 4,108,130 D573E probably damaging Het
Ppp1r35 C T 5: 137,779,144 probably benign Het
Ptprq T C 10: 107,699,635 Q423R probably damaging Het
Pum1 A T 4: 130,762,814 Y699F probably benign Het
Rabgef1 A G 5: 130,213,000 D415G probably benign Het
Rapgef6 A G 11: 54,523,117 E23G probably benign Het
Rpia G T 6: 70,783,579 C121* probably null Het
Serpinb13 T A 1: 106,998,697 W201R probably damaging Het
Sh3bp4 T C 1: 89,137,734 C17R probably damaging Het
Sh3d21 A G 4: 126,162,065 probably benign Het
Slamf6 A C 1: 171,936,682 N214T probably damaging Het
Slc7a2 T C 8: 40,908,093 Y365H possibly damaging Het
Sox18 T C 2: 181,671,178 probably null Het
Spink7 A T 18: 62,592,436 F79I possibly damaging Het
Srpk3 C T X: 73,774,949 R82* probably null Het
Sspo A T 6: 48,493,310 H4561L probably damaging Het
Tcaf1 T C 6: 42,676,859 K700R probably benign Het
Tcf25 G T 8: 123,388,633 R203L probably damaging Het
Tcp11 T C 17: 28,071,783 I201V possibly damaging Het
Tex2 T C 11: 106,546,789 D685G unknown Het
Themis G T 10: 28,761,199 E100* probably null Het
Tmem52b G A 6: 129,514,258 probably null Het
Tnr C T 1: 159,684,656 probably benign Het
Tox3 T C 8: 90,248,816 I396V probably benign Het
Tpm2 T A 4: 43,514,828 E269V probably benign Het
Tulp1 C T 17: 28,362,677 probably benign Het
Tymp GC GCC 15: 89,374,364 probably null Het
Ube2j2 A C 4: 155,949,058 K30Q possibly damaging Het
Usp19 T A 9: 108,492,608 M1K probably null Het
Vmn2r52 C A 7: 10,176,270 R6L probably benign Het
Zbed4 G A 15: 88,781,087 V453M probably benign Het
Zfp319 T C 8: 95,328,471 E368G probably benign Het
Zfp366 A C 13: 99,229,609 E426A probably damaging Het
Zfp687 A T 3: 95,009,466 I783N probably damaging Het
Other mutations in Arfgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0097:Arfgap2 UTSW 2 91274815 missense probably benign 0.16
R0097:Arfgap2 UTSW 2 91274815 missense probably benign 0.16
R0178:Arfgap2 UTSW 2 91267361 missense probably benign 0.00
R0927:Arfgap2 UTSW 2 91273805 missense probably benign 0.05
R1491:Arfgap2 UTSW 2 91274859 missense probably damaging 1.00
R1693:Arfgap2 UTSW 2 91270075 splice site probably null
R2091:Arfgap2 UTSW 2 91270241 missense probably benign 0.02
R2199:Arfgap2 UTSW 2 91265692 critical splice donor site probably null
R3772:Arfgap2 UTSW 2 91265366 missense probably benign
R3922:Arfgap2 UTSW 2 91274805 missense probably damaging 1.00
R3926:Arfgap2 UTSW 2 91274805 missense probably damaging 1.00
R4707:Arfgap2 UTSW 2 91269971 missense probably damaging 1.00
R4751:Arfgap2 UTSW 2 91267368 missense probably benign 0.10
R4923:Arfgap2 UTSW 2 91273659 missense probably damaging 1.00
R5541:Arfgap2 UTSW 2 91275769 missense probably benign 0.09
R5608:Arfgap2 UTSW 2 91270202 missense probably damaging 1.00
R5626:Arfgap2 UTSW 2 91275392 nonsense probably null
R6261:Arfgap2 UTSW 2 91270282 missense probably benign 0.00
R6300:Arfgap2 UTSW 2 91267195 missense probably benign 0.00
R6948:Arfgap2 UTSW 2 91267179 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAAGACGTCTCTTGTCCCCTG -3'
(R):5'- AGTCTACAGAGGTGGAACCC -3'

Sequencing Primer
(F):5'- CTTGTCCCCTGGGGTCTGAG -3'
(R):5'- GCTGTAGGCTACCAGAACTC -3'
Posted On2016-07-06