Incidental Mutation 'R5171:Donson'
ID398752
Institutional Source Beutler Lab
Gene Symbol Donson
Ensembl Gene ENSMUSG00000022960
Gene Namedownstream neighbor of SON
SynonymsDonson, ORF60, 1110025J21Rik
MMRRC Submission 042751-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R5171 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location91676808-91688770 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91681293 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 258 (V258A)
Ref Sequence ENSEMBL: ENSMUSP00000121386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023682] [ENSMUST00000114031] [ENSMUST00000114037] [ENSMUST00000117159] [ENSMUST00000117633] [ENSMUST00000122302] [ENSMUST00000133942] [ENSMUST00000136699] [ENSMUST00000138560] [ENSMUST00000139324] [ENSMUST00000140312] [ENSMUST00000144461] [ENSMUST00000145833] [ENSMUST00000159295]
Predicted Effect probably benign
Transcript: ENSMUST00000023682
AA Change: V470A

PolyPhen 2 Score 0.397 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000023682
Gene: ENSMUSG00000022960
AA Change: V470A

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
low complexity region 340 361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114031
SMART Domains Protein: ENSMUSP00000109665
Gene: ENSMUSG00000022960

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
low complexity region 340 361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114037
SMART Domains Protein: ENSMUSP00000109671
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.71e-7 PROSPERO
internal_repeat_2 214 362 7.05e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.71e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 7.05e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
G_patch 2321 2367 1.15e-17 SMART
Pfam:DND1_DSRM 2388 2442 5.7e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117159
SMART Domains Protein: ENSMUSP00000113220
Gene: ENSMUSG00000022960

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
low complexity region 340 361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117633
SMART Domains Protein: ENSMUSP00000112453
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 1.59e-7 PROSPERO
internal_repeat_2 214 362 6.63e-6 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 1.59e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 6.63e-6 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
Pfam:RSRP 1909 2216 1e-12 PFAM
G_patch 2321 2367 1.15e-17 SMART
DSRM 2390 2458 5.37e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122302
SMART Domains Protein: ENSMUSP00000113615
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
low complexity region 90 101 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 159 165 N/A INTRINSIC
G_patch 331 377 1.15e-17 SMART
Pfam:DND1_DSRM 398 452 7.9e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123893
Predicted Effect possibly damaging
Transcript: ENSMUST00000133942
AA Change: V258A

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121386
Gene: ENSMUSG00000022960
AA Change: V258A

DomainStartEndE-ValueType
low complexity region 128 149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136699
Predicted Effect possibly damaging
Transcript: ENSMUST00000138560
AA Change: V440A

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121591
Gene: ENSMUSG00000022960
AA Change: V440A

DomainStartEndE-ValueType
low complexity region 31 52 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
low complexity region 310 331 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139324
SMART Domains Protein: ENSMUSP00000120957
Gene: ENSMUSG00000022960

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140312
SMART Domains Protein: ENSMUSP00000122320
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
coiled coil region 106 132 N/A INTRINSIC
internal_repeat_1 155 350 2.93e-7 PROSPERO
internal_repeat_2 214 362 1.1e-5 PROSPERO
low complexity region 391 403 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
internal_repeat_1 507 750 2.93e-7 PROSPERO
low complexity region 975 1021 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1141 1172 N/A INTRINSIC
internal_repeat_2 1208 1347 1.1e-5 PROSPERO
low complexity region 1354 1376 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1805 1811 N/A INTRINSIC
low complexity region 1838 2067 N/A INTRINSIC
low complexity region 2080 2091 N/A INTRINSIC
low complexity region 2094 2105 N/A INTRINSIC
low complexity region 2149 2155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144461
SMART Domains Protein: ENSMUSP00000123648
Gene: ENSMUSG00000022960

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145235
Predicted Effect probably benign
Transcript: ENSMUST00000145833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146079
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147461
Predicted Effect probably benign
Transcript: ENSMUST00000147891
SMART Domains Protein: ENSMUSP00000122544
Gene: ENSMUSG00000022961

DomainStartEndE-ValueType
Pfam:RSRP 61 358 2.9e-13 PFAM
low complexity region 466 477 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151503
Predicted Effect probably benign
Transcript: ENSMUST00000159295
SMART Domains Protein: ENSMUSP00000125172
Gene: ENSMUSG00000116933

DomainStartEndE-ValueType
Pfam:OSCP 1 89 1.1e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231425
Predicted Effect unknown
Transcript: ENSMUST00000231459
AA Change: V6A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232177
Meta Mutation Damage Score 0.0636 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene lies downstream of the SON gene and spans 10 kb on chromosome 21. The function of this gene is unknown. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout is early embryonic lethal. Heterozygous knockout causes no observable phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C A 1: 130,742,847 Q269K probably benign Het
Acad9 T A 3: 36,074,398 I136N possibly damaging Het
Adtrp A G 13: 41,777,563 S183P probably damaging Het
Atp11b C T 3: 35,832,937 T690I probably damaging Het
Bcl2l12 G A 7: 44,991,394 probably benign Het
Btnl7-ps T A 17: 34,533,529 noncoding transcript Het
Ccl12 T C 11: 82,102,634 C33R probably damaging Het
Cdc25a T A 9: 109,877,161 S57R probably benign Het
Coro2a T A 4: 46,542,372 probably benign Het
Cpne6 T C 14: 55,512,148 V55A possibly damaging Het
Ddn A G 15: 98,806,326 S362P possibly damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Gm3336 G A 8: 70,721,875 V163I probably benign Het
Gm8765 A T 13: 50,700,378 T91S possibly damaging Het
Gper1 C T 5: 139,426,658 R253C probably damaging Het
Gpsm1 T A 2: 26,327,464 probably benign Het
Hip1 A G 5: 135,440,302 S251P probably damaging Het
Ifi214 A G 1: 173,526,634 S157P possibly damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kntc1 T C 5: 123,799,844 V1535A probably benign Het
Mbd3l1 A G 9: 18,485,134 N185S probably benign Het
Mnx1 T C 5: 29,474,853 Q252R unknown Het
Mroh3 A T 1: 136,191,656 L463Q possibly damaging Het
Myom1 T C 17: 71,099,972 V1030A possibly damaging Het
Olfr1134 T G 2: 87,656,544 I126L possibly damaging Het
Olfr411 T C 11: 74,346,814 T257A probably benign Het
Olfr988 T C 2: 85,353,770 D52G probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Ranbp17 A G 11: 33,217,419 Y1015H probably benign Het
Rasal1 C T 5: 120,663,764 T256I probably benign Het
Rexo5 T A 7: 119,823,779 I278N probably damaging Het
Rims2 T A 15: 39,437,103 S77T probably damaging Het
Sdk2 C T 11: 113,850,982 A804T probably benign Het
Slc24a2 T A 4: 86,996,634 I589F probably benign Het
Slc25a38 T A 9: 120,122,115 I217K probably benign Het
Slc5a7 T C 17: 54,276,676 T529A probably benign Het
Spata22 T A 11: 73,336,208 S83T probably damaging Het
Stac2 A T 11: 98,043,498 C127S possibly damaging Het
Tep1 T C 14: 50,824,802 H2531R probably benign Het
Tmem151a G T 19: 5,082,033 R382S probably damaging Het
Trim60 T C 8: 65,000,524 T358A probably benign Het
Unc13c T A 9: 73,757,954 M1048L probably benign Het
Usp29 T C 7: 6,962,075 S306P probably damaging Het
Zfp26 T C 9: 20,444,907 K35R probably benign Het
Zfp462 T A 4: 55,016,986 probably null Het
Other mutations in Donson
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Donson APN 16 91682591 missense possibly damaging 0.79
IGL02458:Donson APN 16 91681176 missense probably damaging 0.97
IGL03238:Donson APN 16 91681246 nonsense probably null
IGL02802:Donson UTSW 16 91681308 missense possibly damaging 0.66
R0525:Donson UTSW 16 91686245 missense probably damaging 1.00
R0831:Donson UTSW 16 91683763 missense probably damaging 1.00
R3706:Donson UTSW 16 91686161 unclassified probably benign
R4191:Donson UTSW 16 91688592 missense possibly damaging 0.81
R4746:Donson UTSW 16 91682237 missense probably damaging 1.00
R4788:Donson UTSW 16 91687833 missense possibly damaging 0.66
R4947:Donson UTSW 16 91682551 missense probably damaging 1.00
R5439:Donson UTSW 16 91679926 missense probably damaging 0.99
R5739:Donson UTSW 16 91681229 splice site probably null
R5809:Donson UTSW 16 91687850 missense possibly damaging 0.69
R6964:Donson UTSW 16 91681219 missense probably benign 0.11
R7022:Donson UTSW 16 91681330 missense probably damaging 1.00
R7110:Donson UTSW 16 91682121 nonsense probably null
R7326:Donson UTSW 16 91688711 start codon destroyed probably null 0.99
Predicted Primers PCR Primer
(F):5'- CATTTACCCCAGCAAGAGGATATAG -3'
(R):5'- AGGAGGCCTACTAGACAAGC -3'

Sequencing Primer
(F):5'- ATAGGGTATGACTGGTCTACTTACTC -3'
(R):5'- CAAGTCGCATTCCCAGGAGTTTTG -3'
Posted On2016-07-06