Incidental Mutation 'R5171:Slc5a7'
ID398758
Institutional Source Beutler Lab
Gene Symbol Slc5a7
Ensembl Gene ENSMUSG00000023945
Gene Namesolute carrier family 5 (choline transporter), member 7
SynonymsCHT1
MMRRC Submission 042751-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5171 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location54273594-54299034 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54276676 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 529 (T529A)
Ref Sequence ENSEMBL: ENSMUSP00000093379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095712]
Predicted Effect probably benign
Transcript: ENSMUST00000095712
AA Change: T529A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093379
Gene: ENSMUSG00000023945
AA Change: T529A

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:SSF 42 442 4.7e-36 PFAM
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium ion- and chloride ion-dependent high-affinity transporter that mediates choline uptake for acetylcholine synthesis in cholinergic neurons. The protein transports choline from the extracellular space into presynaptic terminals for synthesis into acetylcholine. Increased choline uptake results from increased density of this protein in synaptosomal plasma membranes in response to depolarization of cholinergic terminals. Dysfunction of cholinergic signaling has been implicated in various disorders including depression, attention-deficit disorder, and schizophrenia. An allelic variant of this gene is associated with autosomal dominant distal hereditary motor neuronopathy type VIIA. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygous null mice display neonatal lethality with respiratory failure, hyporesponsiveness to touch, inability to sustain acetylcholine release, and abnormal neuromuscular junction morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C A 1: 130,742,847 Q269K probably benign Het
Acad9 T A 3: 36,074,398 I136N possibly damaging Het
Adtrp A G 13: 41,777,563 S183P probably damaging Het
Atp11b C T 3: 35,832,937 T690I probably damaging Het
Bcl2l12 G A 7: 44,991,394 probably benign Het
Btnl7-ps T A 17: 34,533,529 noncoding transcript Het
Ccl12 T C 11: 82,102,634 C33R probably damaging Het
Cdc25a T A 9: 109,877,161 S57R probably benign Het
Coro2a T A 4: 46,542,372 probably benign Het
Cpne6 T C 14: 55,512,148 V55A possibly damaging Het
Ddn A G 15: 98,806,326 S362P possibly damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Donson A G 16: 91,681,293 V258A possibly damaging Het
Gm3336 G A 8: 70,721,875 V163I probably benign Het
Gm8765 A T 13: 50,700,378 T91S possibly damaging Het
Gper1 C T 5: 139,426,658 R253C probably damaging Het
Gpsm1 T A 2: 26,327,464 probably benign Het
Hip1 A G 5: 135,440,302 S251P probably damaging Het
Ifi214 A G 1: 173,526,634 S157P possibly damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kntc1 T C 5: 123,799,844 V1535A probably benign Het
Mbd3l1 A G 9: 18,485,134 N185S probably benign Het
Mnx1 T C 5: 29,474,853 Q252R unknown Het
Mroh3 A T 1: 136,191,656 L463Q possibly damaging Het
Myom1 T C 17: 71,099,972 V1030A possibly damaging Het
Olfr1134 T G 2: 87,656,544 I126L possibly damaging Het
Olfr411 T C 11: 74,346,814 T257A probably benign Het
Olfr988 T C 2: 85,353,770 D52G probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Ranbp17 A G 11: 33,217,419 Y1015H probably benign Het
Rasal1 C T 5: 120,663,764 T256I probably benign Het
Rexo5 T A 7: 119,823,779 I278N probably damaging Het
Rims2 T A 15: 39,437,103 S77T probably damaging Het
Sdk2 C T 11: 113,850,982 A804T probably benign Het
Slc24a2 T A 4: 86,996,634 I589F probably benign Het
Slc25a38 T A 9: 120,122,115 I217K probably benign Het
Spata22 T A 11: 73,336,208 S83T probably damaging Het
Stac2 A T 11: 98,043,498 C127S possibly damaging Het
Tep1 T C 14: 50,824,802 H2531R probably benign Het
Tmem151a G T 19: 5,082,033 R382S probably damaging Het
Trim60 T C 8: 65,000,524 T358A probably benign Het
Unc13c T A 9: 73,757,954 M1048L probably benign Het
Usp29 T C 7: 6,962,075 S306P probably damaging Het
Zfp26 T C 9: 20,444,907 K35R probably benign Het
Zfp462 T A 4: 55,016,986 probably null Het
Other mutations in Slc5a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Slc5a7 APN 17 54292960 missense probably benign 0.00
IGL01833:Slc5a7 APN 17 54281833 missense probably damaging 1.00
IGL02206:Slc5a7 APN 17 54296994 missense probably damaging 0.98
IGL02493:Slc5a7 APN 17 54293880 missense probably damaging 1.00
IGL02598:Slc5a7 APN 17 54284193 missense probably benign
IGL02693:Slc5a7 APN 17 54276919 missense probably benign 0.00
IGL02896:Slc5a7 APN 17 54293017 nonsense probably null
R0288:Slc5a7 UTSW 17 54293018 nonsense probably null
R1137:Slc5a7 UTSW 17 54293011 missense probably damaging 1.00
R1692:Slc5a7 UTSW 17 54281726 missense probably damaging 0.99
R1755:Slc5a7 UTSW 17 54292978 missense probably benign 0.01
R1987:Slc5a7 UTSW 17 54293835 missense probably damaging 1.00
R2373:Slc5a7 UTSW 17 54277126 missense probably damaging 1.00
R4170:Slc5a7 UTSW 17 54276858 missense probably benign 0.08
R4614:Slc5a7 UTSW 17 54276559 missense probably benign 0.00
R4785:Slc5a7 UTSW 17 54278700 missense probably damaging 1.00
R4793:Slc5a7 UTSW 17 54281794 missense possibly damaging 0.95
R4828:Slc5a7 UTSW 17 54276799 missense probably benign 0.11
R4847:Slc5a7 UTSW 17 54277140 missense possibly damaging 0.82
R4879:Slc5a7 UTSW 17 54276651 missense probably benign 0.04
R5152:Slc5a7 UTSW 17 54278833 missense possibly damaging 0.51
R5196:Slc5a7 UTSW 17 54281722 critical splice donor site probably null
R5935:Slc5a7 UTSW 17 54276944 nonsense probably null
R6307:Slc5a7 UTSW 17 54276978 missense probably benign 0.12
R6354:Slc5a7 UTSW 17 54277033 missense probably damaging 1.00
R6357:Slc5a7 UTSW 17 54287361 missense probably benign 0.16
R6395:Slc5a7 UTSW 17 54278821 missense probably damaging 1.00
R6500:Slc5a7 UTSW 17 54284203 missense probably benign
R6643:Slc5a7 UTSW 17 54276616 missense probably benign 0.00
R7062:Slc5a7 UTSW 17 54293001 missense probably damaging 1.00
R7405:Slc5a7 UTSW 17 54297133 missense probably benign
R7470:Slc5a7 UTSW 17 54276962 nonsense probably null
R7477:Slc5a7 UTSW 17 54281759 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAGCAATGCCCTCTTCTG -3'
(R):5'- GAGCCATATCTATACTTGCAGCC -3'

Sequencing Primer
(F):5'- GCAATGCCCTCTTCTGTATATTTTAG -3'
(R):5'- ACCCTGGTTATTACTCTGACAAG -3'
Posted On2016-07-06