Incidental Mutation 'R5171:Tmem151a'
List |< first << previous [record 42 of 47] next >> last >|
ID398762
Institutional Source Beutler Lab
Gene Symbol Tmem151a
Ensembl Gene ENSMUSG00000061451
Gene Nametransmembrane protein 151A
SynonymsLOC381199, Tmem151
MMRRC Submission 042751-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R5171 (G1)
Quality Score138
Status Validated
Chromosome19
Chromosomal Location5070859-5085531 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 5082033 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 382 (R382S)
Ref Sequence ENSEMBL: ENSMUSP00000076321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077066] [ENSMUST00000140389] [ENSMUST00000151413]
Predicted Effect probably damaging
Transcript: ENSMUST00000077066
AA Change: R382S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076321
Gene: ENSMUSG00000061451
AA Change: R382S

DomainStartEndE-ValueType
Pfam:TMEM151 26 373 8.6e-179 PFAM
low complexity region 420 431 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136372
Predicted Effect probably benign
Transcript: ENSMUST00000140389
Predicted Effect probably benign
Transcript: ENSMUST00000151413
SMART Domains Protein: ENSMUSP00000121084
Gene: ENSMUSG00000061451

DomainStartEndE-ValueType
low complexity region 37 48 N/A INTRINSIC
Meta Mutation Damage Score 0.164 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C A 1: 130,742,847 Q269K probably benign Het
Acad9 T A 3: 36,074,398 I136N possibly damaging Het
Adtrp A G 13: 41,777,563 S183P probably damaging Het
Atp11b C T 3: 35,832,937 T690I probably damaging Het
Bcl2l12 G A 7: 44,991,394 probably benign Het
Btnl7-ps T A 17: 34,533,529 noncoding transcript Het
Ccl12 T C 11: 82,102,634 C33R probably damaging Het
Cdc25a T A 9: 109,877,161 S57R probably benign Het
Coro2a T A 4: 46,542,372 probably benign Het
Cpne6 T C 14: 55,512,148 V55A possibly damaging Het
Ddn A G 15: 98,806,326 S362P possibly damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Donson A G 16: 91,681,293 V258A possibly damaging Het
Gm3336 G A 8: 70,721,875 V163I probably benign Het
Gm8765 A T 13: 50,700,378 T91S possibly damaging Het
Gper1 C T 5: 139,426,658 R253C probably damaging Het
Gpsm1 T A 2: 26,327,464 probably benign Het
Hip1 A G 5: 135,440,302 S251P probably damaging Het
Ifi214 A G 1: 173,526,634 S157P possibly damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kntc1 T C 5: 123,799,844 V1535A probably benign Het
Mbd3l1 A G 9: 18,485,134 N185S probably benign Het
Mnx1 T C 5: 29,474,853 Q252R unknown Het
Mroh3 A T 1: 136,191,656 L463Q possibly damaging Het
Myom1 T C 17: 71,099,972 V1030A possibly damaging Het
Olfr1134 T G 2: 87,656,544 I126L possibly damaging Het
Olfr411 T C 11: 74,346,814 T257A probably benign Het
Olfr988 T C 2: 85,353,770 D52G probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Ranbp17 A G 11: 33,217,419 Y1015H probably benign Het
Rasal1 C T 5: 120,663,764 T256I probably benign Het
Rexo5 T A 7: 119,823,779 I278N probably damaging Het
Rims2 T A 15: 39,437,103 S77T probably damaging Het
Sdk2 C T 11: 113,850,982 A804T probably benign Het
Slc24a2 T A 4: 86,996,634 I589F probably benign Het
Slc25a38 T A 9: 120,122,115 I217K probably benign Het
Slc5a7 T C 17: 54,276,676 T529A probably benign Het
Spata22 T A 11: 73,336,208 S83T probably damaging Het
Stac2 A T 11: 98,043,498 C127S possibly damaging Het
Tep1 T C 14: 50,824,802 H2531R probably benign Het
Trim60 T C 8: 65,000,524 T358A probably benign Het
Unc13c T A 9: 73,757,954 M1048L probably benign Het
Usp29 T C 7: 6,962,075 S306P probably damaging Het
Zfp26 T C 9: 20,444,907 K35R probably benign Het
Zfp462 T A 4: 55,016,986 probably null Het
Other mutations in Tmem151a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01913:Tmem151a APN 19 5081892 missense probably benign 0.36
IGL02708:Tmem151a APN 19 5082847 nonsense probably null
IGL02887:Tmem151a APN 19 5082965 missense probably benign
IGL03144:Tmem151a APN 19 5085372 start codon destroyed probably benign 0.01
R0395:Tmem151a UTSW 19 5082233 missense probably damaging 1.00
R1732:Tmem151a UTSW 19 5082867 missense probably damaging 1.00
R2011:Tmem151a UTSW 19 5082938 missense probably benign
R4399:Tmem151a UTSW 19 5083071 missense probably damaging 1.00
R4612:Tmem151a UTSW 19 5071834 unclassified probably benign
R6921:Tmem151a UTSW 19 5083091 missense probably damaging 1.00
R7205:Tmem151a UTSW 19 5082773 missense probably damaging 1.00
R7413:Tmem151a UTSW 19 5082674 missense probably damaging 1.00
X0010:Tmem151a UTSW 19 5082986 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAAGGGCGTCCTCATAGCAC -3'
(R):5'- TGGAGAAGCTTTTCGGTGCC -3'

Sequencing Primer
(F):5'- TCATAGCACGGAGGGCTTTC -3'
(R):5'- GAAGCTTTTCGGTGCCAGCTC -3'
Posted On2016-07-06