Incidental Mutation 'R0454:Usp19'
ID39890
Institutional Source Beutler Lab
Gene Symbol Usp19
Ensembl Gene ENSMUSG00000006676
Gene Nameubiquitin specific peptidase 19
Synonyms8430421I07Rik
MMRRC Submission 038654-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.383) question?
Stock #R0454 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location108490602-108502337 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 108494240 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006854] [ENSMUST00000065014] [ENSMUST00000085044] [ENSMUST00000166103] [ENSMUST00000178075] [ENSMUST00000193678]
Predicted Effect probably null
Transcript: ENSMUST00000006854
SMART Domains Protein: ENSMUSP00000006854
Gene: ENSMUSG00000006676

DomainStartEndE-ValueType
Pfam:CS 55 129 1.3e-6 PFAM
low complexity region 257 268 N/A INTRINSIC
Pfam:CS 326 414 7.1e-19 PFAM
Pfam:USP19_linker 415 537 2.2e-61 PFAM
Pfam:UCH 538 1253 1.2e-77 PFAM
Pfam:UCH_1 539 874 8.6e-11 PFAM
Pfam:zf-MYND 833 875 9.9e-11 PFAM
Pfam:UCH_1 1021 1235 7.1e-10 PFAM
low complexity region 1278 1287 N/A INTRINSIC
low complexity region 1301 1312 N/A INTRINSIC
transmembrane domain 1333 1355 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065014
SMART Domains Protein: ENSMUSP00000069087
Gene: ENSMUSG00000052911

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
LamNT 44 284 1.9e-102 SMART
EGF_Lam 286 347 1.34e-6 SMART
EGF_Lam 350 410 6.1e-10 SMART
EGF_Lam 413 470 2.98e-13 SMART
EGF_Lam 473 522 7.93e-9 SMART
EGF_Lam 525 569 1.01e-10 SMART
EGF_Lam 784 829 3.42e-13 SMART
EGF_Lam 832 875 6.54e-10 SMART
EGF_Lam 878 925 1.34e-6 SMART
EGF_Lam 928 984 4.74e-7 SMART
EGF_Lam 987 1036 1.53e-10 SMART
EGF_Lam 1039 1093 6.29e-12 SMART
EGF_Lam 1096 1141 1.79e-7 SMART
EGF_Lam 1144 1188 6.64e-11 SMART
coiled coil region 1261 1299 N/A INTRINSIC
low complexity region 1445 1458 N/A INTRINSIC
coiled coil region 1473 1527 N/A INTRINSIC
low complexity region 1609 1625 N/A INTRINSIC
SCOP:d1eq1a_ 1632 1786 5e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000085044
SMART Domains Protein: ENSMUSP00000082119
Gene: ENSMUSG00000006676

DomainStartEndE-ValueType
Pfam:CS 55 129 4.7e-7 PFAM
low complexity region 257 268 N/A INTRINSIC
Pfam:CS 326 414 2.5e-15 PFAM
low complexity region 449 460 N/A INTRINSIC
low complexity region 524 530 N/A INTRINSIC
Pfam:UCH 538 1253 7.4e-84 PFAM
Pfam:UCH_1 539 879 2.3e-13 PFAM
Pfam:zf-MYND 833 875 2.4e-10 PFAM
Pfam:UCH_1 1020 1235 2.9e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000166103
SMART Domains Protein: ENSMUSP00000128573
Gene: ENSMUSG00000006676

DomainStartEndE-ValueType
Pfam:CS 55 129 2.6e-7 PFAM
low complexity region 257 268 N/A INTRINSIC
Pfam:CS 326 390 3.9e-9 PFAM
low complexity region 425 436 N/A INTRINSIC
low complexity region 500 506 N/A INTRINSIC
Pfam:UCH 514 1229 1.8e-84 PFAM
Pfam:UCH_1 515 855 5.5e-14 PFAM
Pfam:zf-MYND 809 851 1.7e-10 PFAM
Pfam:UCH_1 996 1211 6.9e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000178075
SMART Domains Protein: ENSMUSP00000135930
Gene: ENSMUSG00000006676

DomainStartEndE-ValueType
Pfam:CS 55 129 1e-6 PFAM
low complexity region 258 269 N/A INTRINSIC
Pfam:CS 327 415 5.4e-15 PFAM
low complexity region 450 461 N/A INTRINSIC
low complexity region 525 531 N/A INTRINSIC
Pfam:UCH 539 1254 4.9e-84 PFAM
Pfam:UCH_1 540 880 1.4e-13 PFAM
Pfam:zf-MYND 834 876 5.2e-10 PFAM
Pfam:UCH_1 1021 1236 1.8e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192854
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193183
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193412
Predicted Effect probably benign
Transcript: ENSMUST00000193558
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193571
Predicted Effect probably null
Transcript: ENSMUST00000193678
SMART Domains Protein: ENSMUSP00000141738
Gene: ENSMUSG00000006676

DomainStartEndE-ValueType
Pfam:CS 55 129 6.8e-7 PFAM
low complexity region 258 269 N/A INTRINSIC
Pfam:CS 327 415 3.6e-15 PFAM
low complexity region 448 459 N/A INTRINSIC
low complexity region 523 529 N/A INTRINSIC
Pfam:UCH 537 1252 3.8e-84 PFAM
Pfam:UCH_1 538 878 1.1e-13 PFAM
Pfam:zf-MYND 832 874 5.1e-10 PFAM
Pfam:UCH_1 1019 1234 1.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194225
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194499
Predicted Effect probably benign
Transcript: ENSMUST00000194863
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195763
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit decreased body weight, reduced male fertility, and increased resistance to skeletal muscle atrophy induced by both glucocorticoids and denervation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik A G 5: 118,255,821 E88G possibly damaging Het
4930447F04Rik T C X: 66,303,668 E91G unknown Het
Acot1 A G 12: 84,017,339 Q407R probably benign Het
Adcy10 T A 1: 165,570,728 Y1465N probably damaging Het
Ahsa2 T A 11: 23,490,702 I249F probably damaging Het
Arhgap10 T C 8: 77,250,965 N721S probably damaging Het
Arrdc4 T G 7: 68,741,871 E216A probably damaging Het
Axin1 T C 17: 26,173,663 V306A probably benign Het
BC005561 T G 5: 104,518,211 S200A probably benign Het
Cct3 T C 3: 88,302,866 probably null Het
Cfap58 G A 19: 47,974,680 probably null Het
Chd9 T C 8: 90,973,231 S49P possibly damaging Het
Clcn2 C A 16: 20,710,428 probably null Het
Col26a1 T C 5: 136,754,193 N286D probably benign Het
Cpt1b T A 15: 89,424,393 I111F possibly damaging Het
Cyp4f16 T A 17: 32,537,087 I30N probably damaging Het
Ddc T G 11: 11,880,587 D19A possibly damaging Het
Depdc1a T A 3: 159,516,900 probably null Het
Evc2 T A 5: 37,417,484 C1028S possibly damaging Het
Fam228a T C 12: 4,731,457 E134G probably damaging Het
Fasl T C 1: 161,787,954 E111G probably benign Het
Fbxw10 A G 11: 62,876,738 N800S possibly damaging Het
Fras1 T C 5: 96,762,665 S3318P probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gad1 T A 2: 70,579,201 M212K probably damaging Het
Gm17455 T G 10: 60,402,973 S6A probably benign Het
Grm5 T C 7: 88,130,789 S1146P probably damaging Het
Gsn T C 2: 35,304,639 L649P probably damaging Het
H2-DMb1 A G 17: 34,155,711 T112A probably benign Het
Hcn3 T A 3: 89,152,894 I148F probably damaging Het
Hdac10 T C 15: 89,125,758 probably null Het
Hk3 C A 13: 55,008,705 D619Y probably damaging Het
Ifi44 T A 3: 151,745,497 R272S possibly damaging Het
Il1rap A C 16: 26,698,875 D275A probably damaging Het
Itgam A T 7: 128,107,980 N660I probably benign Het
Itpr3 T C 17: 27,113,819 M1853T probably benign Het
Lrmp A G 6: 145,167,984 R293G possibly damaging Het
Lrrc8c A C 5: 105,607,099 K247Q probably damaging Het
Map3k21 T C 8: 125,942,119 S815P probably benign Het
Mast4 A G 13: 102,751,560 S1114P probably damaging Het
Myh8 C T 11: 67,303,765 Q1601* probably null Het
Nhlrc2 A G 19: 56,570,527 D148G probably damaging Het
Nos1 T A 5: 117,943,320 S1196T probably benign Het
Nsmaf C T 4: 6,424,874 probably null Het
Obscn T C 11: 58,999,623 D7361G unknown Het
Olfr1350 C T 7: 6,570,360 A123V probably damaging Het
Olfr600 C A 7: 103,346,878 A17S probably benign Het
Olfr721-ps1 T C 14: 14,407,777 V183A probably damaging Het
Pank3 T G 11: 35,777,709 M175R probably benign Het
Papolg A G 11: 23,879,868 probably null Het
Pcdhb21 G A 18: 37,514,513 D232N probably damaging Het
Pcdhb22 T C 18: 37,518,872 F131S probably damaging Het
Pik3r6 G A 11: 68,528,782 A140T possibly damaging Het
Pinlyp T C 7: 24,542,522 T87A possibly damaging Het
Pld1 T C 3: 28,124,575 S873P probably damaging Het
Pld5 T A 1: 176,274,729 Y49F probably benign Het
Polq T C 16: 37,034,890 V449A probably damaging Het
Prkca A G 11: 107,978,280 V69A probably benign Het
Ptk6 A G 2: 181,202,282 S75P possibly damaging Het
Ptprq G A 10: 107,582,530 Q1662* probably null Het
Ptprt C A 2: 161,553,822 A1144S probably damaging Het
Rrm1 T A 7: 102,466,926 W684R probably damaging Het
Ryr1 T A 7: 29,036,075 M4093L probably damaging Het
Scnn1a C T 6: 125,322,226 L90F probably damaging Het
Slc25a19 G T 11: 115,617,597 Y188* probably null Het
Slc31a1 C T 4: 62,385,629 probably benign Het
Slc5a11 C G 7: 123,265,235 S351R possibly damaging Het
Slc6a17 A G 3: 107,476,867 L387P probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Spam1 T A 6: 24,797,838 L331Q probably damaging Het
Spata32 A G 11: 103,209,299 W127R probably damaging Het
Spta1 T G 1: 174,213,942 I1324S probably damaging Het
St6galnac4 A G 2: 32,594,318 Y176C probably damaging Het
Stk10 A G 11: 32,596,724 E327G probably damaging Het
Stxbp5l T A 16: 37,134,284 Y912F possibly damaging Het
Tchp G A 5: 114,720,182 E459K probably benign Het
Terf2 C T 8: 107,096,210 W100* probably null Het
Thrsp T C 7: 97,417,427 N26S probably damaging Het
Tln1 C A 4: 43,553,504 R297L probably benign Het
Tmeff2 C A 1: 50,928,075 T43N possibly damaging Het
Tmx1 C T 12: 70,453,173 A2V possibly damaging Het
Tnks1bp1 T A 2: 85,072,137 L1053Q probably damaging Het
Trmt10b A T 4: 45,304,286 K107N probably damaging Het
Trpa1 A T 1: 14,885,748 probably null Het
Trrap A G 5: 144,846,477 K3371R probably damaging Het
Tuba3b G A 6: 145,618,269 V14I probably benign Het
Usp28 C A 9: 49,039,101 D615E possibly damaging Het
Utp20 T C 10: 88,822,069 D43G probably benign Het
Vmn1r58 T G 7: 5,410,998 K78Q possibly damaging Het
Vmn2r10 T C 5: 109,003,461 M96V probably benign Het
Wdr90 T C 17: 25,860,049 E273G probably damaging Het
Xpc C T 6: 91,491,226 A860T probably benign Het
Zscan21 T C 5: 138,133,603 I463T possibly damaging Het
Other mutations in Usp19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Usp19 APN 9 108498961 missense possibly damaging 0.79
IGL02345:Usp19 APN 9 108493858 missense probably benign
IGL03026:Usp19 APN 9 108493145 missense probably damaging 1.00
IGL03057:Usp19 APN 9 108499130 missense probably benign 0.01
IGL03073:Usp19 APN 9 108495803 unclassified probably benign
IGL03333:Usp19 APN 9 108494149 missense probably benign 0.05
PIT4504001:Usp19 UTSW 9 108492970 missense probably benign 0.00
PIT4576001:Usp19 UTSW 9 108492732 critical splice donor site probably null
R0053:Usp19 UTSW 9 108497170 splice site probably null
R0053:Usp19 UTSW 9 108497170 splice site probably null
R0138:Usp19 UTSW 9 108501315 missense possibly damaging 0.86
R0281:Usp19 UTSW 9 108498509 missense probably damaging 1.00
R0386:Usp19 UTSW 9 108499711 missense probably damaging 1.00
R0506:Usp19 UTSW 9 108494487 missense probably damaging 1.00
R0542:Usp19 UTSW 9 108494385 unclassified probably null
R0800:Usp19 UTSW 9 108495154 missense probably damaging 0.97
R0829:Usp19 UTSW 9 108493801 missense probably benign
R1594:Usp19 UTSW 9 108498522 missense probably damaging 1.00
R1917:Usp19 UTSW 9 108499325 nonsense probably null
R3744:Usp19 UTSW 9 108500181 missense probably damaging 1.00
R3964:Usp19 UTSW 9 108498029 missense probably damaging 1.00
R4275:Usp19 UTSW 9 108498694 missense probably damaging 1.00
R4789:Usp19 UTSW 9 108493234 missense possibly damaging 0.75
R5247:Usp19 UTSW 9 108496065 splice site probably null
R5249:Usp19 UTSW 9 108492608 start codon destroyed probably null 0.85
R5400:Usp19 UTSW 9 108500193 missense probably damaging 1.00
R5445:Usp19 UTSW 9 108497920 missense possibly damaging 0.61
R5578:Usp19 UTSW 9 108493440 missense probably benign
R5934:Usp19 UTSW 9 108492567 unclassified probably benign
R6003:Usp19 UTSW 9 108496380 missense probably damaging 1.00
R6217:Usp19 UTSW 9 108500144 missense probably damaging 1.00
R6230:Usp19 UTSW 9 108501941 missense probably damaging 0.99
R6505:Usp19 UTSW 9 108496883 missense probably damaging 1.00
R6585:Usp19 UTSW 9 108499727 missense probably damaging 0.97
R6865:Usp19 UTSW 9 108498819 nonsense probably null
R6953:Usp19 UTSW 9 108498931 missense possibly damaging 0.90
R7037:Usp19 UTSW 9 108496958 missense possibly damaging 0.52
R7046:Usp19 UTSW 9 108497135 missense possibly damaging 0.48
R7235:Usp19 UTSW 9 108494924 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCTCTGTGCTCCACCAATGAAC -3'
(R):5'- AGTGTGAAGTCCTGCTCTCGGAAG -3'

Sequencing Primer
(F):5'- CACTCAAACAAGTCTCTTGAGC -3'
(R):5'- GGATCTCCTTCACGTACACG -3'
Posted On2013-05-23