Incidental Mutation 'R5173:Cul5'
ID398905
Institutional Source Beutler Lab
Gene Symbol Cul5
Ensembl Gene ENSMUSG00000032030
Gene Namecullin 5
SynonymsVACM-1, C030032G03Rik, C330021I08Rik, 8430423K24Rik, 4921514I20Rik
MMRRC Submission 042753-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5173 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location53614582-53670014 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53642734 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 291 (T291A)
Ref Sequence ENSEMBL: ENSMUSP00000133144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034529] [ENSMUST00000120122] [ENSMUST00000166367]
Predicted Effect probably benign
Transcript: ENSMUST00000034529
AA Change: T291A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034529
Gene: ENSMUSG00000032030
AA Change: T291A

DomainStartEndE-ValueType
PDB:2WZK|A 76 461 N/A PDB
SCOP:d1ldja2 91 459 1e-109 SMART
CULLIN 510 661 1.12e-80 SMART
Cullin_Nedd8 782 849 5.12e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082688
Predicted Effect probably benign
Transcript: ENSMUST00000120122
AA Change: T87A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113490
Gene: ENSMUSG00000032030
AA Change: T87A

DomainStartEndE-ValueType
PDB:4JGH|D 1 258 N/A PDB
SCOP:d1ldja2 5 255 2e-75 SMART
CULLIN 306 457 1.12e-80 SMART
Cullin_Nedd8 578 645 5.12e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137922
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141180
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146405
Predicted Effect probably benign
Transcript: ENSMUST00000166367
AA Change: T291A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133144
Gene: ENSMUSG00000032030
AA Change: T291A

DomainStartEndE-ValueType
PDB:2WZK|A 76 434 N/A PDB
SCOP:d1ldja2 91 432 9e-99 SMART
CULLIN 483 634 1.12e-80 SMART
Cullin_Nedd8 755 822 5.12e-17 SMART
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit complete embryonic lethality. Mice heterozygous for a null allele exhibit decreased susceptibility to LPS-induced lung injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik G A 1: 85,100,567 R54* probably null Het
Abca13 AC A 11: 9,682,032 probably null Het
Abca6 A T 11: 110,191,720 F1142L probably benign Het
Ap1g1 T A 8: 109,851,132 probably null Het
Apob T C 12: 8,008,238 V2207A probably benign Het
Cenpp CAAACCTGAAAA CAAA 13: 49,464,782 probably null Het
Chd3 A G 11: 69,369,243 probably benign Het
Coch C A 12: 51,596,507 Y103* probably null Het
Cul3 A T 1: 80,281,416 D382E possibly damaging Het
Dab1 T C 4: 104,688,448 probably null Het
Dmtf1 A G 5: 9,140,356 probably benign Het
Dpp4 T C 2: 62,387,130 Y41C probably damaging Het
Eif2ak4 A G 2: 118,408,360 I45M probably damaging Het
Epn3 T C 11: 94,496,097 K149R probably damaging Het
Flnc A G 6: 29,455,538 E2029G probably damaging Het
Gm5799 A G 14: 43,544,659 N96S probably damaging Het
Gm9573 G T 17: 35,620,741 probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Grik5 T C 7: 25,062,894 H224R possibly damaging Het
Lpar6 A T 14: 73,239,097 E166V probably benign Het
Mical1 T C 10: 41,484,989 L683P probably damaging Het
Mis18bp1 T C 12: 65,149,375 I538M possibly damaging Het
Mobp A G 9: 120,168,245 R77G possibly damaging Het
Mylk A G 16: 34,977,013 H1614R probably benign Het
Olfr1179 G A 2: 88,402,922 T4I probably benign Het
Olfr1388 T C 11: 49,443,886 F12L probably benign Het
Olfr371 T C 8: 85,230,576 L27P probably damaging Het
Osbpl1a C T 18: 12,762,640 V390I probably benign Het
Pcdha7 C A 18: 36,974,652 D243E probably benign Het
Pi4ka A T 16: 17,350,906 N653K possibly damaging Het
Plin5 T G 17: 56,115,548 probably null Het
Plod1 A G 4: 147,916,301 probably benign Het
Psd3 T C 8: 67,696,989 K372E probably damaging Het
Psmd11 C T 11: 80,460,740 T263I probably benign Het
Ptprt A T 2: 161,927,756 N396K probably benign Het
Rab39 T C 9: 53,686,500 E155G probably damaging Het
Rimbp2 T C 5: 128,797,648 D293G probably benign Het
Rnf220 T C 4: 117,289,274 probably benign Het
Rnmt C T 18: 68,321,359 probably benign Het
Slc10a1 T A 12: 80,956,028 I279F probably damaging Het
Taar6 A G 10: 23,985,352 Y99H probably damaging Het
Tas2r144 T A 6: 42,216,114 F263I probably benign Het
Tex15 T A 8: 33,571,740 N399K possibly damaging Het
Tlr9 T A 9: 106,225,952 V814D possibly damaging Het
Tmem53 T A 4: 117,265,711 probably benign Het
Ubap2l T C 3: 90,021,030 I511V possibly damaging Het
Vmn2r60 T C 7: 42,195,511 M766T probably damaging Het
Zfp462 T C 4: 55,011,115 V1027A probably damaging Het
Other mutations in Cul5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01674:Cul5 APN 9 53635007 missense probably damaging 1.00
IGL02043:Cul5 APN 9 53658673 missense probably benign 0.26
IGL02145:Cul5 APN 9 53635075 splice site probably benign
IGL02261:Cul5 APN 9 53635037 missense probably damaging 1.00
IGL02281:Cul5 APN 9 53635049 missense possibly damaging 0.87
IGL02639:Cul5 APN 9 53655342 missense possibly damaging 0.89
IGL02697:Cul5 APN 9 53655331 missense probably benign
IGL02752:Cul5 APN 9 53634978 missense probably damaging 0.98
IGL03017:Cul5 APN 9 53644485 critical splice donor site probably null
IGL03031:Cul5 APN 9 53642675 splice site probably benign
IGL03196:Cul5 APN 9 53625880 missense probably damaging 0.99
R0142:Cul5 UTSW 9 53635050 missense probably damaging 0.98
R0415:Cul5 UTSW 9 53667070 missense probably benign 0.00
R1619:Cul5 UTSW 9 53658593 missense probably benign 0.00
R1675:Cul5 UTSW 9 53646683 missense probably benign 0.00
R2031:Cul5 UTSW 9 53667180 missense probably benign
R2059:Cul5 UTSW 9 53667156 missense probably damaging 0.98
R3401:Cul5 UTSW 9 53621212 missense probably benign 0.02
R3427:Cul5 UTSW 9 53617890 missense probably benign
R3701:Cul5 UTSW 9 53629216 missense probably damaging 0.99
R3702:Cul5 UTSW 9 53629216 missense probably damaging 0.99
R3815:Cul5 UTSW 9 53622943 missense probably benign 0.31
R3848:Cul5 UTSW 9 53617986 missense probably benign 0.34
R3849:Cul5 UTSW 9 53617986 missense probably benign 0.34
R3850:Cul5 UTSW 9 53617986 missense probably benign 0.34
R4592:Cul5 UTSW 9 53633727 splice site probably benign
R4690:Cul5 UTSW 9 53622871 missense probably damaging 1.00
R5154:Cul5 UTSW 9 53625867 missense probably damaging 1.00
R5645:Cul5 UTSW 9 53622943 missense probably benign 0.17
R5868:Cul5 UTSW 9 53658673 missense probably benign 0.26
R5975:Cul5 UTSW 9 53622793 missense probably damaging 1.00
R6251:Cul5 UTSW 9 53646794 missense probably benign 0.40
R6284:Cul5 UTSW 9 53623735 missense probably damaging 1.00
R6415:Cul5 UTSW 9 53646683 missense probably benign 0.00
R7178:Cul5 UTSW 9 53644526 missense probably benign 0.01
R7511:Cul5 UTSW 9 53625969 missense probably damaging 1.00
X0018:Cul5 UTSW 9 53622929 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTCTCGTCGTGTTTCTAAG -3'
(R):5'- TACCTCAGTATGTTATTCATCGGTC -3'

Sequencing Primer
(F):5'- ACTCTCGTCGTGTTTCTAAGTATCGG -3'
(R):5'- ATTTCTGAGTTCGAGGCCAGCC -3'
Posted On2016-07-06