Incidental Mutation 'R5250:Ccdc24'
ID398922
Institutional Source Beutler Lab
Gene Symbol Ccdc24
Ensembl Gene ENSMUSG00000078588
Gene Namecoiled-coil domain containing 24
SynonymsLOC381546
MMRRC Submission 042821-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5250 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location117866524-117872557 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117869629 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 296 (T296A)
Ref Sequence ENSEMBL: ENSMUSP00000129502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030266] [ENSMUST00000030269] [ENSMUST00000063857] [ENSMUST00000084325] [ENSMUST00000106421] [ENSMUST00000106422] [ENSMUST00000131938] [ENSMUST00000149168] [ENSMUST00000163288] [ENSMUST00000164853] [ENSMUST00000166325] [ENSMUST00000167287] [ENSMUST00000167443] [ENSMUST00000169885] [ENSMUST00000171052]
Predicted Effect probably benign
Transcript: ENSMUST00000030266
SMART Domains Protein: ENSMUSP00000030266
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 228 4.2e-59 PFAM
Pfam:Glyco_transf_7C 232 310 2.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030269
SMART Domains Protein: ENSMUSP00000030269
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
Pfam:SNF 27 562 5.1e-234 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063857
SMART Domains Protein: ENSMUSP00000066102
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
Pfam:SNF 27 562 5.1e-234 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084325
SMART Domains Protein: ENSMUSP00000081352
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 230 1.9e-47 PFAM
Pfam:Glyco_transf_7C 232 310 2.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106421
SMART Domains Protein: ENSMUSP00000102029
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 230 1.9e-47 PFAM
Pfam:Glyco_transf_7C 232 310 2.6e-32 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106422
AA Change: T268A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102030
Gene: ENSMUSG00000078588
AA Change: T268A

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
coiled coil region 133 158 N/A INTRINSIC
low complexity region 254 266 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130758
Predicted Effect probably benign
Transcript: ENSMUST00000131938
Predicted Effect probably benign
Transcript: ENSMUST00000149168
SMART Domains Protein: ENSMUSP00000129359
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
low complexity region 91 116 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154439
Predicted Effect probably benign
Transcript: ENSMUST00000163288
SMART Domains Protein: ENSMUSP00000127289
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
Pfam:SNF 46 566 2.1e-212 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164716
Predicted Effect possibly damaging
Transcript: ENSMUST00000164853
AA Change: T268A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132114
Gene: ENSMUSG00000078588
AA Change: T268A

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
coiled coil region 133 158 N/A INTRINSIC
low complexity region 254 266 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166325
SMART Domains Protein: ENSMUSP00000131493
Gene: ENSMUSG00000078588

DomainStartEndE-ValueType
coiled coil region 33 57 N/A INTRINSIC
low complexity region 61 90 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167287
SMART Domains Protein: ENSMUSP00000126161
Gene: ENSMUSG00000078588

DomainStartEndE-ValueType
coiled coil region 13 38 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167443
SMART Domains Protein: ENSMUSP00000128771
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 188 1.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169885
SMART Domains Protein: ENSMUSP00000127093
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
Pfam:SNF 1 450 1.2e-182 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170733
Predicted Effect possibly damaging
Transcript: ENSMUST00000171052
AA Change: T296A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129502
Gene: ENSMUSG00000078588
AA Change: T296A

DomainStartEndE-ValueType
Pfam:CCDC24 21 201 3.9e-67 PFAM
low complexity region 282 294 N/A INTRINSIC
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik C A 11: 97,772,727 W99L possibly damaging Het
4930430A15Rik T G 2: 111,228,077 T124P possibly damaging Het
Adamtsl1 A T 4: 86,216,945 K236* probably null Het
Adgre5 A G 8: 83,733,440 V109A probably benign Het
Adora2a T C 10: 75,326,048 I7T probably damaging Het
Ankrd6 A G 4: 32,860,335 V36A probably damaging Het
Arhgef2 T C 3: 88,633,648 probably null Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atg2b G A 12: 105,635,765 R1651W probably damaging Het
Atp6v0a1 T A 11: 101,043,044 V553D possibly damaging Het
Bard1 G A 1: 71,074,563 L420F probably damaging Het
BC067074 A G 13: 113,319,771 N784D possibly damaging Het
Bcat1 C G 6: 145,047,439 probably null Het
Bpifb5 A T 2: 154,224,961 N45Y probably benign Het
Btbd17 G T 11: 114,791,408 probably benign Het
Col11a1 A G 3: 114,217,170 probably benign Het
Dhx38 A T 8: 109,556,520 V555D probably damaging Het
Dixdc1 T G 9: 50,683,735 E230A possibly damaging Het
Dnah7b T G 1: 46,373,354 V4041G probably damaging Het
Dnhd1 A T 7: 105,685,761 I1021L probably damaging Het
Fgl2 A G 5: 21,375,523 S288G possibly damaging Het
Flt4 T A 11: 49,630,400 I412N possibly damaging Het
Gabrb1 A G 5: 71,869,579 I141V possibly damaging Het
Gpc2 A G 5: 138,278,968 Y66H probably damaging Het
Hoxd3 C T 2: 74,744,306 Q99* probably null Het
Inpp5d T C 1: 87,709,675 V781A probably damaging Het
Larp4b T C 13: 9,170,977 probably benign Het
Lrrfip1 T A 1: 91,115,896 S674R possibly damaging Het
Megf6 A G 4: 154,256,010 T561A possibly damaging Het
Mpo A T 11: 87,803,433 Q83L probably benign Het
Mucl2 T C 15: 103,897,467 N75D possibly damaging Het
Myh13 C T 11: 67,327,259 Q53* probably null Het
Myot T A 18: 44,346,070 D291E probably damaging Het
Nae1 A G 8: 104,530,391 probably null Het
Ncoa2 A T 1: 13,224,689 S2R probably damaging Het
Nktr T A 9: 121,749,792 probably benign Het
Nrxn1 A G 17: 90,535,441 probably benign Het
Olfr115 A G 17: 37,609,960 S264P probably damaging Het
Olfr1437 T C 19: 12,322,066 T254A probably benign Het
Olfr432 T G 1: 174,051,272 F300V probably benign Het
P2rx2 T C 5: 110,341,588 E160G probably damaging Het
Pcdhga11 A T 18: 37,757,937 D666V probably damaging Het
Pcm1 A T 8: 41,312,205 E1484D probably damaging Het
Pdia4 C T 6: 47,796,685 A577T possibly damaging Het
Ppm1e T C 11: 87,230,918 I738V probably benign Het
Ppp1r13b G T 12: 111,844,960 R165S probably benign Het
Rasgrp2 T C 19: 6,404,313 W129R probably damaging Het
Smurf2 A G 11: 106,856,179 probably null Het
Ubr2 G T 17: 46,930,442 Q1729K probably benign Het
Zfp260 T A 7: 30,104,967 H97Q probably damaging Het
Zfp429 G T 13: 67,390,519 R269S probably benign Het
Zfp568 T C 7: 30,017,230 V185A probably benign Het
Other mutations in Ccdc24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Ccdc24 APN 4 117872046 missense probably damaging 1.00
IGL02396:Ccdc24 APN 4 117869629 missense possibly damaging 0.91
IGL03122:Ccdc24 APN 4 117871745 critical splice donor site probably null
R1473:Ccdc24 UTSW 4 117869904 splice site probably benign
R1488:Ccdc24 UTSW 4 117870568 missense possibly damaging 0.88
R1986:Ccdc24 UTSW 4 117872016 missense probably damaging 1.00
R2233:Ccdc24 UTSW 4 117869916 missense possibly damaging 0.53
R4983:Ccdc24 UTSW 4 117872100 missense probably benign 0.06
R5677:Ccdc24 UTSW 4 117869880 intron probably benign
R6092:Ccdc24 UTSW 4 117872448 nonsense probably null
R6265:Ccdc24 UTSW 4 117871177 nonsense probably null
R6284:Ccdc24 UTSW 4 117869653 unclassified probably null
R6736:Ccdc24 UTSW 4 117870535 missense possibly damaging 0.81
R6814:Ccdc24 UTSW 4 117869926 missense probably benign 0.02
R6872:Ccdc24 UTSW 4 117869926 missense probably benign 0.02
R7016:Ccdc24 UTSW 4 117871116 missense probably null 1.00
R7073:Ccdc24 UTSW 4 117872004 missense probably damaging 1.00
Z1088:Ccdc24 UTSW 4 117871063 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAAAGGCTTTGATGGTTAGAACAG -3'
(R):5'- TGAGGTCATCCATTCCCAGC -3'

Sequencing Primer
(F):5'- CAGTTCTAGATAGCACTGACCTG -3'
(R):5'- GAGGTCATCCATTCCCAGCCTTAG -3'
Posted On2016-07-06