Incidental Mutation 'R5250:Dhx38'
ID398952
Institutional Source Beutler Lab
Gene Symbol Dhx38
Ensembl Gene ENSMUSG00000037993
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 38
Synonyms5730550P09Rik, Ddx38, Prp16
MMRRC Submission 042821-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R5250 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location109548011-109565861 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 109556520 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 555 (V555D)
Ref Sequence ENSEMBL: ENSMUSP00000047865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042601]
Predicted Effect probably damaging
Transcript: ENSMUST00000042601
AA Change: V555D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047865
Gene: ENSMUSG00000037993
AA Change: V555D

DomainStartEndE-ValueType
Blast:DEXDc 3 146 2e-46 BLAST
low complexity region 147 204 N/A INTRINSIC
Blast:DEXDc 205 444 1e-105 BLAST
low complexity region 511 525 N/A INTRINSIC
DEXDc 531 715 6.88e-34 SMART
HELICc 759 862 1.11e-19 SMART
HA2 923 1013 3.22e-32 SMART
low complexity region 1163 1194 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212667
Meta Mutation Damage Score 0.424 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a member of the DEAD/H box family of splicing factors. This protein resembles yeast Prp16 more closely than other DEAD/H family members. It is an ATPase and essential for the catalytic step II in pre-mRNA splicing process. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik C A 11: 97,772,727 W99L possibly damaging Het
4930430A15Rik T G 2: 111,228,077 T124P possibly damaging Het
Adamtsl1 A T 4: 86,216,945 K236* probably null Het
Adgre5 A G 8: 83,733,440 V109A probably benign Het
Adora2a T C 10: 75,326,048 I7T probably damaging Het
Ankrd6 A G 4: 32,860,335 V36A probably damaging Het
Arhgef2 T C 3: 88,633,648 probably null Het
Atg14 G A 14: 47,568,199 R70C probably damaging Het
Atg2b G A 12: 105,635,765 R1651W probably damaging Het
Atp6v0a1 T A 11: 101,043,044 V553D possibly damaging Het
Bard1 G A 1: 71,074,563 L420F probably damaging Het
BC067074 A G 13: 113,319,771 N784D possibly damaging Het
Bcat1 C G 6: 145,047,439 probably null Het
Bpifb5 A T 2: 154,224,961 N45Y probably benign Het
Btbd17 G T 11: 114,791,408 probably benign Het
Ccdc24 T C 4: 117,869,629 T296A possibly damaging Het
Col11a1 A G 3: 114,217,170 probably benign Het
Dixdc1 T G 9: 50,683,735 E230A possibly damaging Het
Dnah7b T G 1: 46,373,354 V4041G probably damaging Het
Dnhd1 A T 7: 105,685,761 I1021L probably damaging Het
Fgl2 A G 5: 21,375,523 S288G possibly damaging Het
Flt4 T A 11: 49,630,400 I412N possibly damaging Het
Gabrb1 A G 5: 71,869,579 I141V possibly damaging Het
Gpc2 A G 5: 138,278,968 Y66H probably damaging Het
Hoxd3 C T 2: 74,744,306 Q99* probably null Het
Inpp5d T C 1: 87,709,675 V781A probably damaging Het
Larp4b T C 13: 9,170,977 probably benign Het
Lrrfip1 T A 1: 91,115,896 S674R possibly damaging Het
Megf6 A G 4: 154,256,010 T561A possibly damaging Het
Mpo A T 11: 87,803,433 Q83L probably benign Het
Mucl2 T C 15: 103,897,467 N75D possibly damaging Het
Myh13 C T 11: 67,327,259 Q53* probably null Het
Myot T A 18: 44,346,070 D291E probably damaging Het
Nae1 A G 8: 104,530,391 probably null Het
Ncoa2 A T 1: 13,224,689 S2R probably damaging Het
Nktr T A 9: 121,749,792 probably benign Het
Nrxn1 A G 17: 90,535,441 probably benign Het
Olfr115 A G 17: 37,609,960 S264P probably damaging Het
Olfr1437 T C 19: 12,322,066 T254A probably benign Het
Olfr432 T G 1: 174,051,272 F300V probably benign Het
P2rx2 T C 5: 110,341,588 E160G probably damaging Het
Pcdhga11 A T 18: 37,757,937 D666V probably damaging Het
Pcm1 A T 8: 41,312,205 E1484D probably damaging Het
Pdia4 C T 6: 47,796,685 A577T possibly damaging Het
Ppm1e T C 11: 87,230,918 I738V probably benign Het
Ppp1r13b G T 12: 111,844,960 R165S probably benign Het
Rasgrp2 T C 19: 6,404,313 W129R probably damaging Het
Smurf2 A G 11: 106,856,179 probably null Het
Ubr2 G T 17: 46,930,442 Q1729K probably benign Het
Zfp260 T A 7: 30,104,967 H97Q probably damaging Het
Zfp429 G T 13: 67,390,519 R269S probably benign Het
Zfp568 T C 7: 30,017,230 V185A probably benign Het
Other mutations in Dhx38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Dhx38 APN 8 109556934 missense possibly damaging 0.49
IGL00821:Dhx38 APN 8 109555654 missense probably benign 0.00
IGL00910:Dhx38 APN 8 109559034 missense probably benign 0.07
IGL01011:Dhx38 APN 8 109562691 missense probably benign
IGL01401:Dhx38 APN 8 109552114 missense probably benign 0.15
IGL02133:Dhx38 APN 8 109558241 nonsense probably null
IGL02529:Dhx38 APN 8 109559013 missense probably benign 0.00
IGL02652:Dhx38 APN 8 109556129 missense probably damaging 1.00
IGL03241:Dhx38 APN 8 109562656 missense possibly damaging 0.47
IGL03378:Dhx38 APN 8 109559090 splice site probably null
R0358:Dhx38 UTSW 8 109552462 missense probably benign 0.13
R0375:Dhx38 UTSW 8 109555181 missense possibly damaging 0.89
R0437:Dhx38 UTSW 8 109558629 splice site probably benign
R0481:Dhx38 UTSW 8 109556216 splice site probably benign
R0492:Dhx38 UTSW 8 109561944 splice site probably benign
R0528:Dhx38 UTSW 8 109562661 missense probably benign 0.00
R0607:Dhx38 UTSW 8 109558943 missense probably benign 0.07
R1638:Dhx38 UTSW 8 109553545 missense probably damaging 1.00
R2020:Dhx38 UTSW 8 109556869 splice site probably benign
R2056:Dhx38 UTSW 8 109562720 unclassified probably benign
R2096:Dhx38 UTSW 8 109554259 missense probably damaging 1.00
R2152:Dhx38 UTSW 8 109560674 missense probably benign 0.00
R2154:Dhx38 UTSW 8 109560674 missense probably benign 0.00
R2382:Dhx38 UTSW 8 109556140 missense probably damaging 0.99
R4367:Dhx38 UTSW 8 109553131 missense probably damaging 1.00
R4368:Dhx38 UTSW 8 109553131 missense probably damaging 1.00
R4369:Dhx38 UTSW 8 109553131 missense probably damaging 1.00
R5354:Dhx38 UTSW 8 109555746 missense probably damaging 1.00
R5668:Dhx38 UTSW 8 109553416 missense probably damaging 1.00
R5777:Dhx38 UTSW 8 109556902 missense possibly damaging 0.81
R5784:Dhx38 UTSW 8 109559613 nonsense probably null
R6799:Dhx38 UTSW 8 109553202 missense probably damaging 1.00
R6915:Dhx38 UTSW 8 109559599 missense probably benign 0.15
R6932:Dhx38 UTSW 8 109552675 missense probably damaging 1.00
R7042:Dhx38 UTSW 8 109556985 missense possibly damaging 0.55
R7248:Dhx38 UTSW 8 109558927 missense probably benign 0.15
R7394:Dhx38 UTSW 8 109556523 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCAGCACAAATGGCAGAAG -3'
(R):5'- CTGGTTTCTGGTGAACCCTC -3'

Sequencing Primer
(F):5'- GCTACATGGCTCAGACCTC -3'
(R):5'- TGAACCCTCTGGCCATGAATG -3'
Posted On2016-07-06