Incidental Mutation 'R5174:Olfr1189'
ID398972
Institutional Source Beutler Lab
Gene Symbol Olfr1189
Ensembl Gene ENSMUSG00000068808
Gene Nameolfactory receptor 1189
SynonymsGA_x6K02T2Q125-50079044-50079964, MOR237-2
MMRRC Submission 042754-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R5174 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88586454-88592762 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88592648 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 281 (N281K)
Ref Sequence ENSEMBL: ENSMUSP00000149696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090700] [ENSMUST00000213679]
Predicted Effect probably damaging
Transcript: ENSMUST00000090700
AA Change: N281K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088201
Gene: ENSMUSG00000068808
AA Change: N281K

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 9.6e-42 PFAM
Pfam:7tm_1 39 285 4.4e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213679
AA Change: N281K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.032 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik C T 9: 103,282,556 probably null Het
Ank3 T C 10: 69,892,379 S632P probably damaging Het
Arhgef16 G A 4: 154,282,047 R451W probably damaging Het
Asxl3 A T 18: 22,523,115 D1394V probably benign Het
Atp2a3 T A 11: 72,980,215 I545N probably damaging Het
Cadps2 T A 6: 23,287,743 Y1181F probably damaging Het
Camkmt C A 17: 85,452,237 F268L probably benign Het
Casp14 C T 10: 78,715,391 G20D possibly damaging Het
Celf1 T C 2: 91,001,008 C61R probably damaging Het
Cenpp CAAACCTGAAAA CAAA 13: 49,464,782 probably null Het
Cers3 A T 7: 66,784,868 K203M probably damaging Het
Clip4 T C 17: 71,810,962 F334S probably damaging Het
Cyp2b13 T A 7: 26,088,693 D415E possibly damaging Het
Decr2 A T 17: 26,087,469 probably null Het
Dmxl2 T C 9: 54,445,484 probably null Het
Dnah7b G A 1: 46,243,349 A2881T possibly damaging Het
Dnaja3 A G 16: 4,684,297 H55R probably benign Het
Dnajc11 T C 4: 151,979,984 F531L probably damaging Het
Efcab6 A G 15: 84,054,486 F10L probably benign Het
Epm2aip1 T C 9: 111,273,387 F476S probably damaging Het
Fat3 T C 9: 15,999,570 N1712S probably damaging Het
Flnc T C 6: 29,448,894 V1343A possibly damaging Het
Fsip2 C T 2: 82,980,741 P2468L probably benign Het
Gm5798 A G 14: 41,348,663 H10R possibly damaging Het
Gm7168 A G 17: 13,948,455 Y28C probably damaging Het
Gm9866 A T 12: 27,142,028 noncoding transcript Het
Gtpbp6 G A 5: 110,108,117 R19C possibly damaging Het
Gucy2e A G 11: 69,236,566 F27S probably benign Het
Krba1 A G 6: 48,412,295 E548G probably damaging Het
Ltbr A G 6: 125,309,537 S229P probably benign Het
Mgat5b A T 11: 116,977,715 Y488F probably benign Het
Mia3 T A 1: 183,331,493 K475* probably null Het
Mrpl53 C T 6: 83,109,657 T114M possibly damaging Het
Mrps35 T C 6: 147,060,211 Y195H possibly damaging Het
Muc4 A T 16: 32,751,738 I539F possibly damaging Het
Nedd1 T A 10: 92,711,212 T150S possibly damaging Het
Nox4 T G 7: 87,323,766 I327S probably benign Het
Nrk C G X: 138,986,779 A1018G probably benign Het
Olfr1152 T A 2: 87,868,411 V140E possibly damaging Het
Olfr608 T A 7: 103,470,403 F121L probably benign Het
Olfr984 T C 9: 40,100,747 T248A possibly damaging Het
Pdzd2 G A 15: 12,372,514 P2512S probably benign Het
Ptgis T A 2: 167,203,470 probably null Het
Rnf170 T A 8: 26,129,168 M140K probably benign Het
Scaf4 A T 16: 90,247,174 I637K unknown Het
Sdccag8 A T 1: 176,845,350 T270S probably damaging Het
Sec24d T C 3: 123,364,926 C1022R probably damaging Het
Sec63 T C 10: 42,829,081 probably benign Het
Serpinb3d C G 1: 107,078,498 E287Q possibly damaging Het
Smarcd2 A G 11: 106,267,045 probably benign Het
Sox15 A G 11: 69,655,719 Y116C probably damaging Het
Spag16 T C 1: 70,493,796 S545P probably damaging Het
Ssc5d C A 7: 4,927,971 T184N possibly damaging Het
St6galnac2 A T 11: 116,681,947 F228I probably damaging Het
Syne1 T C 10: 5,041,490 N8408S probably damaging Het
Trank1 A C 9: 111,365,559 T884P probably benign Het
Ubr3 T A 2: 70,009,162 L1540H probably damaging Het
Ugt2b37 C A 5: 87,251,880 M256I probably benign Het
Vmn2r69 G A 7: 85,415,531 T49I possibly damaging Het
Vmn2r72 T A 7: 85,737,840 I839L probably benign Het
Zcrb1 A G 15: 93,387,575 probably null Het
Zfp319 A T 8: 95,328,169 probably null Het
Zfp592 T C 7: 81,038,325 S1000P probably damaging Het
Zfp938 T C 10: 82,226,004 N261D possibly damaging Het
Zfp957 A G 14: 79,213,388 S324P unknown Het
Zswim6 G T 13: 107,726,681 noncoding transcript Het
Other mutations in Olfr1189
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02306:Olfr1189 APN 2 88592606 missense probably benign 0.22
R0115:Olfr1189 UTSW 2 88592655 missense probably damaging 1.00
R0481:Olfr1189 UTSW 2 88592655 missense probably damaging 1.00
R0565:Olfr1189 UTSW 2 88592009 missense probably benign 0.39
R1106:Olfr1189 UTSW 2 88592011 missense probably benign 0.01
R1501:Olfr1189 UTSW 2 88592148 missense possibly damaging 0.94
R1616:Olfr1189 UTSW 2 88592008 missense probably damaging 0.99
R1763:Olfr1189 UTSW 2 88592436 missense probably benign 0.02
R1847:Olfr1189 UTSW 2 88592172 missense probably damaging 1.00
R1989:Olfr1189 UTSW 2 88592599 missense probably damaging 0.99
R3436:Olfr1189 UTSW 2 88592104 missense probably damaging 1.00
R3500:Olfr1189 UTSW 2 88591941 missense probably damaging 1.00
R4410:Olfr1189 UTSW 2 88592421 missense probably benign 0.03
R4463:Olfr1189 UTSW 2 88592632 missense possibly damaging 0.77
R5005:Olfr1189 UTSW 2 88592004 missense probably benign 0.00
R5557:Olfr1189 UTSW 2 88592553 missense probably damaging 1.00
R6354:Olfr1189 UTSW 2 88592134 missense probably damaging 1.00
R6850:Olfr1189 UTSW 2 88592306 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTTATAGTTCTGAAGGGAGACGC -3'
(R):5'- TGCTGGAAACTAAACAGTAGCC -3'

Sequencing Primer
(F):5'- GCAAAGCCCTCTCTACATGTAG -3'
(R):5'- CAGTAGCCAGGAGATAGCTTTATCTG -3'
Posted On2016-07-06