Incidental Mutation 'R5174:Mrpl53'
ID398990
Institutional Source Beutler Lab
Gene Symbol Mrpl53
Ensembl Gene ENSMUSG00000030037
Gene Namemitochondrial ribosomal protein L53
Synonyms1110007K17Rik
MMRRC Submission 042754-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.888) question?
Stock #R5174 (G1)
Quality Score87
Status Validated
Chromosome6
Chromosomal Location83109040-83109939 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 83109657 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 114 (T114M)
Ref Sequence ENSEMBL: ENSMUSP00000109571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101253] [ENSMUST00000101254] [ENSMUST00000113938]
Predicted Effect probably benign
Transcript: ENSMUST00000101253
SMART Domains Protein: ENSMUSP00000098811
Gene: ENSMUSG00000079511

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
low complexity region 70 91 N/A INTRINSIC
low complexity region 102 118 N/A INTRINSIC
low complexity region 173 187 N/A INTRINSIC
low complexity region 238 263 N/A INTRINSIC
Pfam:CCDC142 286 714 1.6e-159 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101254
SMART Domains Protein: ENSMUSP00000098812
Gene: ENSMUSG00000107499

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
low complexity region 70 91 N/A INTRINSIC
low complexity region 102 118 N/A INTRINSIC
low complexity region 173 187 N/A INTRINSIC
low complexity region 238 263 N/A INTRINSIC
Pfam:CCDC142 279 714 8.5e-174 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113938
AA Change: T114M

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109571
Gene: ENSMUSG00000030037
AA Change: T114M

DomainStartEndE-ValueType
Pfam:MRP_L53 20 71 2.7e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141639
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154457
Meta Mutation Damage Score 0.0628 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. A pseudogene corresponding to this gene is found on chromosome 1p. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik C T 9: 103,282,556 probably null Het
Ank3 T C 10: 69,892,379 S632P probably damaging Het
Arhgef16 G A 4: 154,282,047 R451W probably damaging Het
Asxl3 A T 18: 22,523,115 D1394V probably benign Het
Atp2a3 T A 11: 72,980,215 I545N probably damaging Het
Cadps2 T A 6: 23,287,743 Y1181F probably damaging Het
Camkmt C A 17: 85,452,237 F268L probably benign Het
Casp14 C T 10: 78,715,391 G20D possibly damaging Het
Celf1 T C 2: 91,001,008 C61R probably damaging Het
Cenpp CAAACCTGAAAA CAAA 13: 49,464,782 probably null Het
Cers3 A T 7: 66,784,868 K203M probably damaging Het
Clip4 T C 17: 71,810,962 F334S probably damaging Het
Cyp2b13 T A 7: 26,088,693 D415E possibly damaging Het
Decr2 A T 17: 26,087,469 probably null Het
Dmxl2 T C 9: 54,445,484 probably null Het
Dnah7b G A 1: 46,243,349 A2881T possibly damaging Het
Dnaja3 A G 16: 4,684,297 H55R probably benign Het
Dnajc11 T C 4: 151,979,984 F531L probably damaging Het
Efcab6 A G 15: 84,054,486 F10L probably benign Het
Epm2aip1 T C 9: 111,273,387 F476S probably damaging Het
Fat3 T C 9: 15,999,570 N1712S probably damaging Het
Flnc T C 6: 29,448,894 V1343A possibly damaging Het
Fsip2 C T 2: 82,980,741 P2468L probably benign Het
Gm5798 A G 14: 41,348,663 H10R possibly damaging Het
Gm7168 A G 17: 13,948,455 Y28C probably damaging Het
Gm9866 A T 12: 27,142,028 noncoding transcript Het
Gtpbp6 G A 5: 110,108,117 R19C possibly damaging Het
Gucy2e A G 11: 69,236,566 F27S probably benign Het
Krba1 A G 6: 48,412,295 E548G probably damaging Het
Ltbr A G 6: 125,309,537 S229P probably benign Het
Mgat5b A T 11: 116,977,715 Y488F probably benign Het
Mia3 T A 1: 183,331,493 K475* probably null Het
Mrps35 T C 6: 147,060,211 Y195H possibly damaging Het
Muc4 A T 16: 32,751,738 I539F possibly damaging Het
Nedd1 T A 10: 92,711,212 T150S possibly damaging Het
Nox4 T G 7: 87,323,766 I327S probably benign Het
Nrk C G X: 138,986,779 A1018G probably benign Het
Olfr1152 T A 2: 87,868,411 V140E possibly damaging Het
Olfr1189 T A 2: 88,592,648 N281K probably damaging Het
Olfr608 T A 7: 103,470,403 F121L probably benign Het
Olfr984 T C 9: 40,100,747 T248A possibly damaging Het
Pdzd2 G A 15: 12,372,514 P2512S probably benign Het
Ptgis T A 2: 167,203,470 probably null Het
Rnf170 T A 8: 26,129,168 M140K probably benign Het
Scaf4 A T 16: 90,247,174 I637K unknown Het
Sdccag8 A T 1: 176,845,350 T270S probably damaging Het
Sec24d T C 3: 123,364,926 C1022R probably damaging Het
Sec63 T C 10: 42,829,081 probably benign Het
Serpinb3d C G 1: 107,078,498 E287Q possibly damaging Het
Smarcd2 A G 11: 106,267,045 probably benign Het
Sox15 A G 11: 69,655,719 Y116C probably damaging Het
Spag16 T C 1: 70,493,796 S545P probably damaging Het
Ssc5d C A 7: 4,927,971 T184N possibly damaging Het
St6galnac2 A T 11: 116,681,947 F228I probably damaging Het
Syne1 T C 10: 5,041,490 N8408S probably damaging Het
Trank1 A C 9: 111,365,559 T884P probably benign Het
Ubr3 T A 2: 70,009,162 L1540H probably damaging Het
Ugt2b37 C A 5: 87,251,880 M256I probably benign Het
Vmn2r69 G A 7: 85,415,531 T49I possibly damaging Het
Vmn2r72 T A 7: 85,737,840 I839L probably benign Het
Zcrb1 A G 15: 93,387,575 probably null Het
Zfp319 A T 8: 95,328,169 probably null Het
Zfp592 T C 7: 81,038,325 S1000P probably damaging Het
Zfp938 T C 10: 82,226,004 N261D possibly damaging Het
Zfp957 A G 14: 79,213,388 S324P unknown Het
Zswim6 G T 13: 107,726,681 noncoding transcript Het
Other mutations in Mrpl53
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0148:Mrpl53 UTSW 6 83109537 missense probably damaging 1.00
R0362:Mrpl53 UTSW 6 83109545 missense probably damaging 1.00
R0639:Mrpl53 UTSW 6 83109411 missense probably damaging 0.98
R5109:Mrpl53 UTSW 6 83109560 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCGGTAAACCTGGTAGGGAC -3'
(R):5'- TTATCTTGCCCCAGAAGCCC -3'

Sequencing Primer
(F):5'- ATAGCCCTGCATAGTCAGGGTC -3'
(R):5'- CCCAGAAGCCCTGTTGTTAGTG -3'
Posted On2016-07-06