Incidental Mutation 'R5174:Vmn2r72'
ID399004
Institutional Source Beutler Lab
Gene Symbol Vmn2r72
Ensembl Gene ENSMUSG00000051877
Gene Namevomeronasal 2, receptor 72
SynonymsVmn2r72-ps, EG244114
MMRRC Submission 042754-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R5174 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location85737784-85754981 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85737840 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 839 (I839L)
Ref Sequence ENSEMBL: ENSMUSP00000133014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063425]
Predicted Effect probably benign
Transcript: ENSMUST00000063425
AA Change: I839L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000133014
Gene: ENSMUSG00000051877
AA Change: I839L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 82 469 2.3e-28 PFAM
Pfam:NCD3G 512 564 1.2e-18 PFAM
Pfam:7tm_3 594 832 4e-53 PFAM
Meta Mutation Damage Score 0.1092 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik C T 9: 103,282,556 probably null Het
Ank3 T C 10: 69,892,379 S632P probably damaging Het
Arhgef16 G A 4: 154,282,047 R451W probably damaging Het
Asxl3 A T 18: 22,523,115 D1394V probably benign Het
Atp2a3 T A 11: 72,980,215 I545N probably damaging Het
Cadps2 T A 6: 23,287,743 Y1181F probably damaging Het
Camkmt C A 17: 85,452,237 F268L probably benign Het
Casp14 C T 10: 78,715,391 G20D possibly damaging Het
Celf1 T C 2: 91,001,008 C61R probably damaging Het
Cenpp CAAACCTGAAAA CAAA 13: 49,464,782 probably null Het
Cers3 A T 7: 66,784,868 K203M probably damaging Het
Clip4 T C 17: 71,810,962 F334S probably damaging Het
Cyp2b13 T A 7: 26,088,693 D415E possibly damaging Het
Decr2 A T 17: 26,087,469 probably null Het
Dmxl2 T C 9: 54,445,484 probably null Het
Dnah7b G A 1: 46,243,349 A2881T possibly damaging Het
Dnaja3 A G 16: 4,684,297 H55R probably benign Het
Dnajc11 T C 4: 151,979,984 F531L probably damaging Het
Efcab6 A G 15: 84,054,486 F10L probably benign Het
Epm2aip1 T C 9: 111,273,387 F476S probably damaging Het
Fat3 T C 9: 15,999,570 N1712S probably damaging Het
Flnc T C 6: 29,448,894 V1343A possibly damaging Het
Fsip2 C T 2: 82,980,741 P2468L probably benign Het
Gm5798 A G 14: 41,348,663 H10R possibly damaging Het
Gm7168 A G 17: 13,948,455 Y28C probably damaging Het
Gm9866 A T 12: 27,142,028 noncoding transcript Het
Gtpbp6 G A 5: 110,108,117 R19C possibly damaging Het
Gucy2e A G 11: 69,236,566 F27S probably benign Het
Krba1 A G 6: 48,412,295 E548G probably damaging Het
Ltbr A G 6: 125,309,537 S229P probably benign Het
Mgat5b A T 11: 116,977,715 Y488F probably benign Het
Mia3 T A 1: 183,331,493 K475* probably null Het
Mrpl53 C T 6: 83,109,657 T114M possibly damaging Het
Mrps35 T C 6: 147,060,211 Y195H possibly damaging Het
Muc4 A T 16: 32,751,738 I539F possibly damaging Het
Nedd1 T A 10: 92,711,212 T150S possibly damaging Het
Nox4 T G 7: 87,323,766 I327S probably benign Het
Nrk C G X: 138,986,779 A1018G probably benign Het
Olfr1152 T A 2: 87,868,411 V140E possibly damaging Het
Olfr1189 T A 2: 88,592,648 N281K probably damaging Het
Olfr608 T A 7: 103,470,403 F121L probably benign Het
Olfr984 T C 9: 40,100,747 T248A possibly damaging Het
Pdzd2 G A 15: 12,372,514 P2512S probably benign Het
Ptgis T A 2: 167,203,470 probably null Het
Rnf170 T A 8: 26,129,168 M140K probably benign Het
Scaf4 A T 16: 90,247,174 I637K unknown Het
Sdccag8 A T 1: 176,845,350 T270S probably damaging Het
Sec24d T C 3: 123,364,926 C1022R probably damaging Het
Sec63 T C 10: 42,829,081 probably benign Het
Serpinb3d C G 1: 107,078,498 E287Q possibly damaging Het
Smarcd2 A G 11: 106,267,045 probably benign Het
Sox15 A G 11: 69,655,719 Y116C probably damaging Het
Spag16 T C 1: 70,493,796 S545P probably damaging Het
Ssc5d C A 7: 4,927,971 T184N possibly damaging Het
St6galnac2 A T 11: 116,681,947 F228I probably damaging Het
Syne1 T C 10: 5,041,490 N8408S probably damaging Het
Trank1 A C 9: 111,365,559 T884P probably benign Het
Ubr3 T A 2: 70,009,162 L1540H probably damaging Het
Ugt2b37 C A 5: 87,251,880 M256I probably benign Het
Vmn2r69 G A 7: 85,415,531 T49I possibly damaging Het
Zcrb1 A G 15: 93,387,575 probably null Het
Zfp319 A T 8: 95,328,169 probably null Het
Zfp592 T C 7: 81,038,325 S1000P probably damaging Het
Zfp938 T C 10: 82,226,004 N261D possibly damaging Het
Zfp957 A G 14: 79,213,388 S324P unknown Het
Zswim6 G T 13: 107,726,681 noncoding transcript Het
Other mutations in Vmn2r72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Vmn2r72 APN 7 85749646 missense probably benign 0.01
IGL01019:Vmn2r72 APN 7 85738334 missense probably benign 0.26
IGL01445:Vmn2r72 APN 7 85749646 missense probably benign 0.06
IGL02076:Vmn2r72 APN 7 85738367 missense probably damaging 1.00
IGL02082:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02086:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02089:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02125:Vmn2r72 APN 7 85750711 missense probably benign 0.00
IGL02146:Vmn2r72 APN 7 85737962 missense probably damaging 1.00
IGL02272:Vmn2r72 APN 7 85750693 missense probably benign
IGL02514:Vmn2r72 APN 7 85738699 missense possibly damaging 0.90
IGL02662:Vmn2r72 APN 7 85738183 missense probably benign 0.26
IGL02697:Vmn2r72 APN 7 85738671 missense probably benign 0.36
IGL02733:Vmn2r72 APN 7 85751813 missense probably benign 0.05
IGL03070:Vmn2r72 APN 7 85752041 splice site probably benign
IGL03150:Vmn2r72 APN 7 85751176 missense probably damaging 1.00
IGL03159:Vmn2r72 APN 7 85754954 missense probably benign 0.05
IGL03333:Vmn2r72 APN 7 85750867 missense probably benign 0.10
R0081:Vmn2r72 UTSW 7 85751836 missense probably benign 0.01
R0090:Vmn2r72 UTSW 7 85754876 missense probably benign
R0655:Vmn2r72 UTSW 7 85738111 nonsense probably null
R0778:Vmn2r72 UTSW 7 85749739 missense probably benign 0.00
R1169:Vmn2r72 UTSW 7 85751309 missense probably benign 0.01
R1172:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1173:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1175:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1248:Vmn2r72 UTSW 7 85749188 missense probably benign 0.02
R1302:Vmn2r72 UTSW 7 85738257 missense probably damaging 1.00
R1506:Vmn2r72 UTSW 7 85749211 missense probably benign
R1632:Vmn2r72 UTSW 7 85751792 missense probably benign 0.13
R1775:Vmn2r72 UTSW 7 85738170 missense probably benign 0.01
R1962:Vmn2r72 UTSW 7 85749161 missense probably benign 0.00
R2201:Vmn2r72 UTSW 7 85738236 missense probably benign 0.12
R2290:Vmn2r72 UTSW 7 85738341 missense probably damaging 1.00
R2327:Vmn2r72 UTSW 7 85738256 missense probably damaging 1.00
R2424:Vmn2r72 UTSW 7 85750953 missense probably damaging 1.00
R2655:Vmn2r72 UTSW 7 85751269 missense possibly damaging 0.95
R2860:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R2861:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R2862:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R3009:Vmn2r72 UTSW 7 85749642 missense probably benign 0.00
R3797:Vmn2r72 UTSW 7 85738077 missense probably benign 0.44
R3798:Vmn2r72 UTSW 7 85738077 missense probably benign 0.44
R3902:Vmn2r72 UTSW 7 85749735 missense possibly damaging 0.52
R3959:Vmn2r72 UTSW 7 85751131 missense probably benign 0.36
R3974:Vmn2r72 UTSW 7 85749809 missense probably damaging 1.00
R4399:Vmn2r72 UTSW 7 85738500 missense probably damaging 1.00
R4421:Vmn2r72 UTSW 7 85738500 missense probably damaging 1.00
R4426:Vmn2r72 UTSW 7 85737828 nonsense probably null
R4522:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4523:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4533:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4691:Vmn2r72 UTSW 7 85737911 nonsense probably null
R4781:Vmn2r72 UTSW 7 85737861 missense probably benign 0.14
R4863:Vmn2r72 UTSW 7 85750598 missense possibly damaging 0.91
R4952:Vmn2r72 UTSW 7 85751109 missense probably benign
R4991:Vmn2r72 UTSW 7 85751130 missense probably damaging 0.99
R4995:Vmn2r72 UTSW 7 85738485 missense probably damaging 1.00
R5095:Vmn2r72 UTSW 7 85737853 missense probably damaging 0.98
R5276:Vmn2r72 UTSW 7 85738254 missense possibly damaging 0.90
R5395:Vmn2r72 UTSW 7 85750897 missense possibly damaging 0.71
R5560:Vmn2r72 UTSW 7 85751942 missense probably damaging 0.96
R5933:Vmn2r72 UTSW 7 85737850 missense probably benign 0.05
R6033:Vmn2r72 UTSW 7 85737929 missense probably damaging 1.00
R6033:Vmn2r72 UTSW 7 85737929 missense probably damaging 1.00
R6354:Vmn2r72 UTSW 7 85750539 critical splice donor site probably null
R6362:Vmn2r72 UTSW 7 85751174 missense probably damaging 1.00
R6594:Vmn2r72 UTSW 7 85749684 missense probably benign 0.32
R6794:Vmn2r72 UTSW 7 85737996 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAACAAACTAAGGTCCAGGTC -3'
(R):5'- CTCTTGACATTCAGCATGCTG -3'

Sequencing Primer
(F):5'- AACTAAGGTCCAGGTCATGTTTTTG -3'
(R):5'- ACATTCAGCATGCTGGTGTTC -3'
Posted On2016-07-06