Incidental Mutation 'R5174:Trank1'
ID399024
Institutional Source Beutler Lab
Gene Symbol Trank1
Ensembl Gene ENSMUSG00000062296
Gene Nametetratricopeptide repeat and ankyrin repeat containing 1
SynonymsA230061D21Rik, LOC235639, C030048J01Rik, Lba1
MMRRC Submission 042754-MU
Accession Numbers

Genbank: NM_001164659.1; Ensembl: ENSMUST00000078626

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5174 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location111311739-111395775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 111365559 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 884 (T884P)
Ref Sequence ENSEMBL: ENSMUSP00000077697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078626]
Predicted Effect probably benign
Transcript: ENSMUST00000078626
AA Change: T884P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000077697
Gene: ENSMUSG00000062296
AA Change: T884P

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
low complexity region 34 52 N/A INTRINSIC
low complexity region 113 129 N/A INTRINSIC
Blast:TPR 144 177 1e-15 BLAST
Blast:TPR 178 209 8e-13 BLAST
Blast:ANK 332 361 1e-6 BLAST
ANK 369 405 5.29e0 SMART
ANK 538 567 2.11e2 SMART
ANK 572 609 7.29e2 SMART
ANK 621 652 1.21e2 SMART
low complexity region 887 895 N/A INTRINSIC
low complexity region 1152 1172 N/A INTRINSIC
Blast:AAA 1351 1569 1e-6 BLAST
low complexity region 2166 2177 N/A INTRINSIC
low complexity region 2395 2411 N/A INTRINSIC
low complexity region 2636 2649 N/A INTRINSIC
low complexity region 2966 2983 N/A INTRINSIC
Meta Mutation Damage Score 0.006 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (69/70)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik C T 9: 103,282,556 probably null Het
Ank3 T C 10: 69,892,379 S632P probably damaging Het
Arhgef16 G A 4: 154,282,047 R451W probably damaging Het
Asxl3 A T 18: 22,523,115 D1394V probably benign Het
Atp2a3 T A 11: 72,980,215 I545N probably damaging Het
Cadps2 T A 6: 23,287,743 Y1181F probably damaging Het
Camkmt C A 17: 85,452,237 F268L probably benign Het
Casp14 C T 10: 78,715,391 G20D possibly damaging Het
Celf1 T C 2: 91,001,008 C61R probably damaging Het
Cenpp CAAACCTGAAAA CAAA 13: 49,464,782 probably null Het
Cers3 A T 7: 66,784,868 K203M probably damaging Het
Clip4 T C 17: 71,810,962 F334S probably damaging Het
Cyp2b13 T A 7: 26,088,693 D415E possibly damaging Het
Decr2 A T 17: 26,087,469 probably null Het
Dmxl2 T C 9: 54,445,484 probably null Het
Dnah7b G A 1: 46,243,349 A2881T possibly damaging Het
Dnaja3 A G 16: 4,684,297 H55R probably benign Het
Dnajc11 T C 4: 151,979,984 F531L probably damaging Het
Efcab6 A G 15: 84,054,486 F10L probably benign Het
Epm2aip1 T C 9: 111,273,387 F476S probably damaging Het
Fat3 T C 9: 15,999,570 N1712S probably damaging Het
Flnc T C 6: 29,448,894 V1343A possibly damaging Het
Fsip2 C T 2: 82,980,741 P2468L probably benign Het
Gm5798 A G 14: 41,348,663 H10R possibly damaging Het
Gm7168 A G 17: 13,948,455 Y28C probably damaging Het
Gm9866 A T 12: 27,142,028 noncoding transcript Het
Gtpbp6 G A 5: 110,108,117 R19C possibly damaging Het
Gucy2e A G 11: 69,236,566 F27S probably benign Het
Krba1 A G 6: 48,412,295 E548G probably damaging Het
Ltbr A G 6: 125,309,537 S229P probably benign Het
Mgat5b A T 11: 116,977,715 Y488F probably benign Het
Mia3 T A 1: 183,331,493 K475* probably null Het
Mrpl53 C T 6: 83,109,657 T114M possibly damaging Het
Mrps35 T C 6: 147,060,211 Y195H possibly damaging Het
Muc4 A T 16: 32,751,738 I539F possibly damaging Het
Nedd1 T A 10: 92,711,212 T150S possibly damaging Het
Nox4 T G 7: 87,323,766 I327S probably benign Het
Nrk C G X: 138,986,779 A1018G probably benign Het
Olfr1152 T A 2: 87,868,411 V140E possibly damaging Het
Olfr1189 T A 2: 88,592,648 N281K probably damaging Het
Olfr608 T A 7: 103,470,403 F121L probably benign Het
Olfr984 T C 9: 40,100,747 T248A possibly damaging Het
Pdzd2 G A 15: 12,372,514 P2512S probably benign Het
Ptgis T A 2: 167,203,470 probably null Het
Rnf170 T A 8: 26,129,168 M140K probably benign Het
Scaf4 A T 16: 90,247,174 I637K unknown Het
Sdccag8 A T 1: 176,845,350 T270S probably damaging Het
Sec24d T C 3: 123,364,926 C1022R probably damaging Het
Sec63 T C 10: 42,829,081 probably benign Het
Serpinb3d C G 1: 107,078,498 E287Q possibly damaging Het
Smarcd2 A G 11: 106,267,045 probably benign Het
Sox15 A G 11: 69,655,719 Y116C probably damaging Het
Spag16 T C 1: 70,493,796 S545P probably damaging Het
Ssc5d C A 7: 4,927,971 T184N possibly damaging Het
St6galnac2 A T 11: 116,681,947 F228I probably damaging Het
Syne1 T C 10: 5,041,490 N8408S probably damaging Het
Ubr3 T A 2: 70,009,162 L1540H probably damaging Het
Ugt2b37 C A 5: 87,251,880 M256I probably benign Het
Vmn2r69 G A 7: 85,415,531 T49I possibly damaging Het
Vmn2r72 T A 7: 85,737,840 I839L probably benign Het
Zcrb1 A G 15: 93,387,575 probably null Het
Zfp319 A T 8: 95,328,169 probably null Het
Zfp592 T C 7: 81,038,325 S1000P probably damaging Het
Zfp938 T C 10: 82,226,004 N261D possibly damaging Het
Zfp957 A G 14: 79,213,388 S324P unknown Het
Zswim6 G T 13: 107,726,681 noncoding transcript Het
Other mutations in Trank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Trank1 APN 9 111392609 missense probably damaging 1.00
IGL00467:Trank1 APN 9 111364666 splice site probably benign
IGL00569:Trank1 APN 9 111345511 missense possibly damaging 0.69
IGL00585:Trank1 APN 9 111349290 missense possibly damaging 0.82
IGL01070:Trank1 APN 9 111366793 missense probably damaging 1.00
IGL01134:Trank1 APN 9 111391781 missense probably benign
IGL01154:Trank1 APN 9 111386400 missense probably benign 0.00
IGL01355:Trank1 APN 9 111365520 missense possibly damaging 0.94
IGL01407:Trank1 APN 9 111364722 missense probably damaging 0.99
IGL01410:Trank1 APN 9 111365049 missense probably benign 0.00
IGL01410:Trank1 APN 9 111365259 missense probably benign 0.00
IGL01504:Trank1 APN 9 111373544 missense probably damaging 1.00
IGL01744:Trank1 APN 9 111349363 missense probably damaging 1.00
IGL02043:Trank1 APN 9 111363960 missense probably damaging 0.98
IGL02104:Trank1 APN 9 111390712 missense possibly damaging 0.85
IGL02193:Trank1 APN 9 111367276 missense probably benign 0.43
IGL02581:Trank1 APN 9 111383125 missense probably benign 0.00
IGL02630:Trank1 APN 9 111373075 missense possibly damaging 0.70
IGL02839:Trank1 APN 9 111364756 missense probably damaging 1.00
IGL02897:Trank1 APN 9 111367517 missense probably damaging 0.99
IGL03065:Trank1 APN 9 111390293 missense possibly damaging 0.64
IGL03123:Trank1 APN 9 111367407 missense probably damaging 1.00
IGL03143:Trank1 APN 9 111366087 missense probably damaging 1.00
IGL03323:Trank1 APN 9 111352116 missense probably damaging 1.00
1mM(1):Trank1 UTSW 9 111392981 missense probably damaging 1.00
R0035:Trank1 UTSW 9 111366776 missense probably benign 0.00
R0064:Trank1 UTSW 9 111343195 missense probably damaging 1.00
R0064:Trank1 UTSW 9 111343195 missense probably damaging 1.00
R0089:Trank1 UTSW 9 111392910 missense probably benign 0.00
R0207:Trank1 UTSW 9 111366253 missense probably damaging 1.00
R0255:Trank1 UTSW 9 111366024 missense possibly damaging 0.92
R0334:Trank1 UTSW 9 111365353 missense probably benign 0.00
R0334:Trank1 UTSW 9 111392940 missense probably damaging 1.00
R0383:Trank1 UTSW 9 111391477 missense probably benign 0.08
R0421:Trank1 UTSW 9 111391839 missense probably damaging 1.00
R0494:Trank1 UTSW 9 111391293 missense probably benign 0.19
R0518:Trank1 UTSW 9 111333808 missense probably damaging 1.00
R0560:Trank1 UTSW 9 111391086 missense possibly damaging 0.88
R0637:Trank1 UTSW 9 111390441 missense probably damaging 1.00
R0731:Trank1 UTSW 9 111365488 missense probably damaging 1.00
R0761:Trank1 UTSW 9 111366613 missense probably damaging 1.00
R0766:Trank1 UTSW 9 111347469 missense probably benign 0.45
R0827:Trank1 UTSW 9 111349417 unclassified probably benign
R1005:Trank1 UTSW 9 111333721 missense probably benign 0.13
R1108:Trank1 UTSW 9 111365307 missense probably benign 0.00
R1155:Trank1 UTSW 9 111366970 missense possibly damaging 0.95
R1470:Trank1 UTSW 9 111343232 missense possibly damaging 0.91
R1470:Trank1 UTSW 9 111343232 missense possibly damaging 0.91
R1596:Trank1 UTSW 9 111366290 missense possibly damaging 0.93
R1601:Trank1 UTSW 9 111373477 missense probably damaging 1.00
R1751:Trank1 UTSW 9 111391479 missense probably benign
R1754:Trank1 UTSW 9 111392871 missense probably benign 0.00
R1767:Trank1 UTSW 9 111391479 missense probably benign
R1768:Trank1 UTSW 9 111392927 missense probably damaging 0.96
R1809:Trank1 UTSW 9 111392825 missense probably benign 0.34
R1912:Trank1 UTSW 9 111390709 missense probably benign 0.00
R1920:Trank1 UTSW 9 111347928 critical splice donor site probably null
R1960:Trank1 UTSW 9 111391628 missense probably damaging 1.00
R1993:Trank1 UTSW 9 111378832 missense probably benign 0.20
R2012:Trank1 UTSW 9 111365028 missense probably benign
R2025:Trank1 UTSW 9 111392039 missense probably benign 0.01
R2050:Trank1 UTSW 9 111364788 missense probably damaging 1.00
R2857:Trank1 UTSW 9 111366933 missense probably benign 0.00
R2912:Trank1 UTSW 9 111392483 missense probably damaging 0.98
R2962:Trank1 UTSW 9 111352080 missense probably damaging 1.00
R3030:Trank1 UTSW 9 111391530 missense possibly damaging 0.63
R3821:Trank1 UTSW 9 111378819 missense probably damaging 1.00
R3822:Trank1 UTSW 9 111378819 missense probably damaging 1.00
R3892:Trank1 UTSW 9 111364759 missense probably benign 0.03
R4105:Trank1 UTSW 9 111352197 missense probably damaging 1.00
R4166:Trank1 UTSW 9 111373524 nonsense probably null
R4237:Trank1 UTSW 9 111367035 missense probably benign 0.04
R4239:Trank1 UTSW 9 111367035 missense probably benign 0.04
R4394:Trank1 UTSW 9 111365197 missense possibly damaging 0.86
R4417:Trank1 UTSW 9 111365968 missense probably benign 0.17
R4611:Trank1 UTSW 9 111362261 missense probably damaging 1.00
R4694:Trank1 UTSW 9 111392061 missense probably benign 0.40
R4731:Trank1 UTSW 9 111390410 missense probably damaging 1.00
R4843:Trank1 UTSW 9 111366078 missense probably benign 0.00
R4852:Trank1 UTSW 9 111391895 missense possibly damaging 0.68
R4859:Trank1 UTSW 9 111365010 missense probably benign 0.17
R4868:Trank1 UTSW 9 111365641 missense probably damaging 1.00
R5080:Trank1 UTSW 9 111389221 missense probably damaging 0.99
R5156:Trank1 UTSW 9 111390694 missense probably damaging 1.00
R5234:Trank1 UTSW 9 111386467 missense probably damaging 1.00
R5386:Trank1 UTSW 9 111362402 missense probably benign 0.12
R5419:Trank1 UTSW 9 111391301 missense probably damaging 1.00
R5435:Trank1 UTSW 9 111391890 missense probably benign 0.00
R5444:Trank1 UTSW 9 111392958 missense probably benign 0.04
R5543:Trank1 UTSW 9 111366112 missense probably damaging 0.97
R5560:Trank1 UTSW 9 111390567 missense probably damaging 1.00
R5772:Trank1 UTSW 9 111366676 missense possibly damaging 0.86
R5774:Trank1 UTSW 9 111391226 missense probably damaging 1.00
R5843:Trank1 UTSW 9 111365860 missense possibly damaging 0.59
R5858:Trank1 UTSW 9 111392536 missense probably benign
R5878:Trank1 UTSW 9 111366685 missense possibly damaging 0.93
R5900:Trank1 UTSW 9 111391716 missense probably damaging 1.00
R5917:Trank1 UTSW 9 111362417 missense probably benign 0.38
R5954:Trank1 UTSW 9 111365133 missense probably benign 0.13
R6041:Trank1 UTSW 9 111377796 missense possibly damaging 0.94
R6112:Trank1 UTSW 9 111391737 missense probably damaging 1.00
R6165:Trank1 UTSW 9 111391872 missense probably benign 0.00
R6255:Trank1 UTSW 9 111352246 critical splice donor site probably null
R6395:Trank1 UTSW 9 111367200 missense probably damaging 1.00
R6567:Trank1 UTSW 9 111347521 missense probably benign 0.02
R6644:Trank1 UTSW 9 111364834 missense possibly damaging 0.85
R6724:Trank1 UTSW 9 111365916 missense probably damaging 1.00
R6788:Trank1 UTSW 9 111390679 missense probably damaging 1.00
R6831:Trank1 UTSW 9 111377899 missense probably benign 0.00
R6934:Trank1 UTSW 9 111373090 missense probably damaging 0.99
X0064:Trank1 UTSW 9 111343236 missense possibly damaging 0.57
Z1088:Trank1 UTSW 9 111364710 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGGCTTCACAACTTGTTCCAG -3'
(R):5'- TTCCAGGGAGTAGGTGTTCC -3'

Sequencing Primer
(F):5'- CACAACTTGTTCCAGTTGGTAAC -3'
(R):5'- TCAGAGTTCTCACTGCACCGAG -3'
Posted On2016-07-06