Incidental Mutation 'R5251:Zbtb38'
ID 399043
Institutional Source Beutler Lab
Gene Symbol Zbtb38
Ensembl Gene ENSMUSG00000040433
Gene Name zinc finger and BTB domain containing 38
Synonyms A930014K01Rik, Zenon homolog, CIBZ
MMRRC Submission 042822-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.588) question?
Stock # R5251 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 96564820-96613728 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 96569161 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Asparagine at position 641 (T641N)
Ref Sequence ENSEMBL: ENSMUSP00000114300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093798] [ENSMUST00000126066] [ENSMUST00000128269] [ENSMUST00000140121] [ENSMUST00000152594]
AlphaFold Q3LR78
Predicted Effect probably benign
Transcript: ENSMUST00000093798
AA Change: T641N

PolyPhen 2 Score 0.372 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000091315
Gene: ENSMUSG00000040433
AA Change: T641N

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
ZnF_C2H2 340 362 7.67e-2 SMART
ZnF_C2H2 369 396 7.29e0 SMART
low complexity region 435 446 N/A INTRINSIC
ZnF_C2H2 458 480 2.2e-2 SMART
ZnF_C2H2 486 508 1.05e1 SMART
ZnF_C2H2 514 537 8.09e-1 SMART
low complexity region 911 935 N/A INTRINSIC
low complexity region 994 1002 N/A INTRINSIC
ZnF_C2H2 1013 1035 3.63e-3 SMART
ZnF_C2H2 1041 1063 9.73e-4 SMART
ZnF_C2H2 1069 1091 1.45e-2 SMART
ZnF_C2H2 1097 1119 1.02e1 SMART
ZnF_C2H2 1128 1150 1.67e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126066
AA Change: T641N

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114300
Gene: ENSMUSG00000040433
AA Change: T641N

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
ZnF_C2H2 340 362 7.67e-2 SMART
ZnF_C2H2 369 396 7.29e0 SMART
low complexity region 435 446 N/A INTRINSIC
ZnF_C2H2 458 480 2.2e-2 SMART
ZnF_C2H2 486 508 1.05e1 SMART
ZnF_C2H2 514 537 8.09e-1 SMART
low complexity region 911 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128269
SMART Domains Protein: ENSMUSP00000121871
Gene: ENSMUSG00000040433

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140121
SMART Domains Protein: ENSMUSP00000120040
Gene: ENSMUSG00000040433

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
ZnF_C2H2 340 362 7.67e-2 SMART
ZnF_C2H2 369 396 7.29e0 SMART
low complexity region 435 446 N/A INTRINSIC
ZnF_C2H2 458 480 2.2e-2 SMART
ZnF_C2H2 486 508 1.05e1 SMART
ZnF_C2H2 514 537 8.09e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152594
AA Change: T641N

PolyPhen 2 Score 0.372 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000121753
Gene: ENSMUSG00000040433
AA Change: T641N

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
ZnF_C2H2 340 362 7.67e-2 SMART
ZnF_C2H2 369 396 7.29e0 SMART
low complexity region 435 446 N/A INTRINSIC
ZnF_C2H2 458 480 2.2e-2 SMART
ZnF_C2H2 486 508 1.05e1 SMART
ZnF_C2H2 514 537 8.09e-1 SMART
low complexity region 911 935 N/A INTRINSIC
low complexity region 994 1002 N/A INTRINSIC
ZnF_C2H2 1013 1035 3.63e-3 SMART
ZnF_C2H2 1041 1063 9.73e-4 SMART
ZnF_C2H2 1069 1091 1.45e-2 SMART
ZnF_C2H2 1097 1119 1.02e1 SMART
ZnF_C2H2 1128 1150 1.67e-2 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcriptional activator that binds methylated DNA. The encoded protein can form homodimers or heterodimers through the zinc finger domains. In mouse, inhibition of this protein has been associated with apoptosis in some cell types. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1 A T 5: 36,108,236 (GRCm39) E194V probably damaging Het
Ankrd16 T A 2: 11,783,552 (GRCm39) D51E probably damaging Het
Arhgef5 A G 6: 43,249,815 (GRCm39) T189A possibly damaging Het
Camk4 A G 18: 33,317,932 (GRCm39) D363G probably benign Het
Camta1 A G 4: 151,248,341 (GRCm39) I199T probably damaging Het
Ccdc141 C T 2: 76,858,118 (GRCm39) C1021Y probably damaging Het
Cdc34 C T 10: 79,521,090 (GRCm39) S129L probably damaging Het
Cenph T A 13: 100,898,348 (GRCm39) N185I possibly damaging Het
Colq A G 14: 31,261,776 (GRCm39) probably null Het
Dph2 A T 4: 117,747,543 (GRCm39) D280E probably damaging Het
Exosc5 A G 7: 25,367,180 (GRCm39) Y224C probably damaging Het
Fgfr3 C T 5: 33,892,900 (GRCm39) probably benign Het
Hs3st6 T A 17: 24,976,959 (GRCm39) D146E probably benign Het
Igkv13-84 A T 6: 68,916,772 (GRCm39) Q23L probably benign Het
Macf1 A G 4: 123,343,760 (GRCm39) V2154A probably benign Het
Man1a2 T C 3: 100,527,415 (GRCm39) E225G probably damaging Het
Mertk T C 2: 128,571,375 (GRCm39) S110P probably damaging Het
Nav3 A G 10: 109,689,114 (GRCm39) F388L probably damaging Het
Nme8 T C 13: 19,844,795 (GRCm39) N98S probably benign Het
Nup205 A G 6: 35,173,417 (GRCm39) probably null Het
Prl7d1 T C 13: 27,893,227 (GRCm39) N228S probably benign Het
Prss23 T C 7: 89,159,530 (GRCm39) K180E probably damaging Het
Psap G A 10: 60,137,479 (GRCm39) D549N probably damaging Het
Sec16a A G 2: 26,329,357 (GRCm39) V886A probably benign Het
Sh2d1b2 A T 1: 170,077,642 (GRCm39) E81D probably benign Het
Tbx6 A T 7: 126,382,516 (GRCm39) N254I probably damaging Het
Tchhl1 T C 3: 93,377,860 (GRCm39) V188A possibly damaging Het
Trpc3 A T 3: 36,725,103 (GRCm39) L291Q probably damaging Het
Other mutations in Zbtb38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Zbtb38 APN 9 96,569,547 (GRCm39) missense probably damaging 1.00
IGL01895:Zbtb38 APN 9 96,570,461 (GRCm39) missense probably benign 0.00
IGL02513:Zbtb38 APN 9 96,569,126 (GRCm39) missense probably damaging 1.00
IGL02649:Zbtb38 APN 9 96,568,672 (GRCm39) missense probably damaging 0.96
IGL02938:Zbtb38 APN 9 96,569,227 (GRCm39) missense probably benign 0.11
PIT4131001:Zbtb38 UTSW 9 96,568,369 (GRCm39) missense probably damaging 1.00
R0048:Zbtb38 UTSW 9 96,569,729 (GRCm39) missense probably damaging 1.00
R0152:Zbtb38 UTSW 9 96,568,333 (GRCm39) missense probably damaging 1.00
R0158:Zbtb38 UTSW 9 96,568,993 (GRCm39) missense possibly damaging 0.46
R0519:Zbtb38 UTSW 9 96,567,826 (GRCm39) missense probably damaging 1.00
R0594:Zbtb38 UTSW 9 96,568,007 (GRCm39) missense probably damaging 1.00
R1556:Zbtb38 UTSW 9 96,569,044 (GRCm39) missense probably benign 0.26
R1698:Zbtb38 UTSW 9 96,567,515 (GRCm39) missense probably benign
R1772:Zbtb38 UTSW 9 96,570,094 (GRCm39) missense probably damaging 1.00
R1799:Zbtb38 UTSW 9 96,570,934 (GRCm39) missense probably damaging 1.00
R1837:Zbtb38 UTSW 9 96,569,048 (GRCm39) missense probably benign
R2446:Zbtb38 UTSW 9 96,569,699 (GRCm39) missense probably damaging 1.00
R3153:Zbtb38 UTSW 9 96,570,302 (GRCm39) missense probably benign 0.34
R3950:Zbtb38 UTSW 9 96,569,599 (GRCm39) missense probably damaging 1.00
R4240:Zbtb38 UTSW 9 96,568,155 (GRCm39) small deletion probably benign
R4630:Zbtb38 UTSW 9 96,570,904 (GRCm39) missense probably damaging 1.00
R4666:Zbtb38 UTSW 9 96,570,436 (GRCm39) missense probably damaging 1.00
R4732:Zbtb38 UTSW 9 96,569,737 (GRCm39) missense probably damaging 1.00
R4733:Zbtb38 UTSW 9 96,569,737 (GRCm39) missense probably damaging 1.00
R4824:Zbtb38 UTSW 9 96,570,254 (GRCm39) missense probably benign 0.06
R5006:Zbtb38 UTSW 9 96,567,704 (GRCm39) missense probably damaging 1.00
R5109:Zbtb38 UTSW 9 96,569,062 (GRCm39) missense probably damaging 0.99
R5396:Zbtb38 UTSW 9 96,569,696 (GRCm39) missense probably damaging 1.00
R5659:Zbtb38 UTSW 9 96,569,473 (GRCm39) missense probably damaging 1.00
R6249:Zbtb38 UTSW 9 96,568,045 (GRCm39) missense probably damaging 0.99
R6294:Zbtb38 UTSW 9 96,569,282 (GRCm39) missense probably benign 0.05
R6615:Zbtb38 UTSW 9 96,568,707 (GRCm39) nonsense probably null
R6625:Zbtb38 UTSW 9 96,569,366 (GRCm39) missense probably damaging 1.00
R6885:Zbtb38 UTSW 9 96,568,517 (GRCm39) missense probably damaging 1.00
R7304:Zbtb38 UTSW 9 96,569,480 (GRCm39) missense probably damaging 0.96
R7675:Zbtb38 UTSW 9 96,567,594 (GRCm39) missense probably benign 0.00
R7823:Zbtb38 UTSW 9 96,568,029 (GRCm39) nonsense probably null
R7900:Zbtb38 UTSW 9 96,570,989 (GRCm39) missense probably damaging 1.00
R8077:Zbtb38 UTSW 9 96,570,153 (GRCm39) missense probably benign
R8432:Zbtb38 UTSW 9 96,568,291 (GRCm39) missense possibly damaging 0.68
R8802:Zbtb38 UTSW 9 96,567,623 (GRCm39) missense probably benign 0.13
R8930:Zbtb38 UTSW 9 96,568,434 (GRCm39) missense probably benign 0.04
R8932:Zbtb38 UTSW 9 96,568,434 (GRCm39) missense probably benign 0.04
R9008:Zbtb38 UTSW 9 96,569,100 (GRCm39) missense probably benign
R9347:Zbtb38 UTSW 9 96,567,649 (GRCm39) missense probably damaging 0.99
R9520:Zbtb38 UTSW 9 96,568,104 (GRCm39) missense probably damaging 0.99
R9568:Zbtb38 UTSW 9 96,570,944 (GRCm39) missense probably damaging 1.00
R9680:Zbtb38 UTSW 9 96,570,397 (GRCm39) missense probably benign 0.03
R9777:Zbtb38 UTSW 9 96,570,356 (GRCm39) missense probably damaging 0.96
R9777:Zbtb38 UTSW 9 96,570,355 (GRCm39) missense possibly damaging 0.49
R9790:Zbtb38 UTSW 9 96,570,700 (GRCm39) missense probably damaging 1.00
R9791:Zbtb38 UTSW 9 96,570,700 (GRCm39) missense probably damaging 1.00
X0066:Zbtb38 UTSW 9 96,569,665 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGTGCACAATGACGGAG -3'
(R):5'- AGTGCTCAAGGAAGCAGTC -3'

Sequencing Primer
(F):5'- TGTAGCTGATCACAGAGGCC -3'
(R):5'- TCAAAGGGGTGAATCTGCCC -3'
Posted On 2016-07-06