Incidental Mutation 'R5174:Smarcd2'
ID399044
Institutional Source Beutler Lab
Gene Symbol Smarcd2
Ensembl Gene ENSMUSG00000078619
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2
SynonymsBaf60b
MMRRC Submission 042754-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.874) question?
Stock #R5174 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location106263179-106272972 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 106267045 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021049] [ENSMUST00000021052] [ENSMUST00000106843] [ENSMUST00000133131] [ENSMUST00000140255]
Predicted Effect probably benign
Transcript: ENSMUST00000021049
SMART Domains Protein: ENSMUSP00000021049
Gene: ENSMUSG00000020708

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
AAA 182 321 6.96e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021052
SMART Domains Protein: ENSMUSP00000021052
Gene: ENSMUSG00000078619

DomainStartEndE-ValueType
low complexity region 5 42 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 122 131 N/A INTRINSIC
Blast:KISc 136 287 2e-36 BLAST
SWIB 307 386 1.3e-21 SMART
Blast:MYSc 468 514 5e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106841
Predicted Effect probably benign
Transcript: ENSMUST00000106843
SMART Domains Protein: ENSMUSP00000102456
Gene: ENSMUSG00000078619

DomainStartEndE-ValueType
low complexity region 75 84 N/A INTRINSIC
Blast:KISc 89 240 1e-36 BLAST
SWIB 260 339 1.3e-21 SMART
Blast:MYSc 421 467 5e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132278
Predicted Effect probably benign
Transcript: ENSMUST00000133131
SMART Domains Protein: ENSMUSP00000138057
Gene: ENSMUSG00000020708

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
AAA 182 321 6.96e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140255
SMART Domains Protein: ENSMUSP00000133629
Gene: ENSMUSG00000078619

DomainStartEndE-ValueType
SWIB 29 108 1.3e-21 SMART
Blast:MYSc 190 236 6e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174253
Meta Mutation Damage Score 0.0556 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and has sequence similarity to the yeast Swp73 protein. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik C T 9: 103,282,556 probably null Het
Ank3 T C 10: 69,892,379 S632P probably damaging Het
Arhgef16 G A 4: 154,282,047 R451W probably damaging Het
Asxl3 A T 18: 22,523,115 D1394V probably benign Het
Atp2a3 T A 11: 72,980,215 I545N probably damaging Het
Cadps2 T A 6: 23,287,743 Y1181F probably damaging Het
Camkmt C A 17: 85,452,237 F268L probably benign Het
Casp14 C T 10: 78,715,391 G20D possibly damaging Het
Celf1 T C 2: 91,001,008 C61R probably damaging Het
Cenpp CAAACCTGAAAA CAAA 13: 49,464,782 probably null Het
Cers3 A T 7: 66,784,868 K203M probably damaging Het
Clip4 T C 17: 71,810,962 F334S probably damaging Het
Cyp2b13 T A 7: 26,088,693 D415E possibly damaging Het
Decr2 A T 17: 26,087,469 probably null Het
Dmxl2 T C 9: 54,445,484 probably null Het
Dnah7b G A 1: 46,243,349 A2881T possibly damaging Het
Dnaja3 A G 16: 4,684,297 H55R probably benign Het
Dnajc11 T C 4: 151,979,984 F531L probably damaging Het
Efcab6 A G 15: 84,054,486 F10L probably benign Het
Epm2aip1 T C 9: 111,273,387 F476S probably damaging Het
Fat3 T C 9: 15,999,570 N1712S probably damaging Het
Flnc T C 6: 29,448,894 V1343A possibly damaging Het
Fsip2 C T 2: 82,980,741 P2468L probably benign Het
Gm5798 A G 14: 41,348,663 H10R possibly damaging Het
Gm7168 A G 17: 13,948,455 Y28C probably damaging Het
Gm9866 A T 12: 27,142,028 noncoding transcript Het
Gtpbp6 G A 5: 110,108,117 R19C possibly damaging Het
Gucy2e A G 11: 69,236,566 F27S probably benign Het
Krba1 A G 6: 48,412,295 E548G probably damaging Het
Ltbr A G 6: 125,309,537 S229P probably benign Het
Mgat5b A T 11: 116,977,715 Y488F probably benign Het
Mia3 T A 1: 183,331,493 K475* probably null Het
Mrpl53 C T 6: 83,109,657 T114M possibly damaging Het
Mrps35 T C 6: 147,060,211 Y195H possibly damaging Het
Muc4 A T 16: 32,751,738 I539F possibly damaging Het
Nedd1 T A 10: 92,711,212 T150S possibly damaging Het
Nox4 T G 7: 87,323,766 I327S probably benign Het
Nrk C G X: 138,986,779 A1018G probably benign Het
Olfr1152 T A 2: 87,868,411 V140E possibly damaging Het
Olfr1189 T A 2: 88,592,648 N281K probably damaging Het
Olfr608 T A 7: 103,470,403 F121L probably benign Het
Olfr984 T C 9: 40,100,747 T248A possibly damaging Het
Pdzd2 G A 15: 12,372,514 P2512S probably benign Het
Ptgis T A 2: 167,203,470 probably null Het
Rnf170 T A 8: 26,129,168 M140K probably benign Het
Scaf4 A T 16: 90,247,174 I637K unknown Het
Sdccag8 A T 1: 176,845,350 T270S probably damaging Het
Sec24d T C 3: 123,364,926 C1022R probably damaging Het
Sec63 T C 10: 42,829,081 probably benign Het
Serpinb3d C G 1: 107,078,498 E287Q possibly damaging Het
Sox15 A G 11: 69,655,719 Y116C probably damaging Het
Spag16 T C 1: 70,493,796 S545P probably damaging Het
Ssc5d C A 7: 4,927,971 T184N possibly damaging Het
St6galnac2 A T 11: 116,681,947 F228I probably damaging Het
Syne1 T C 10: 5,041,490 N8408S probably damaging Het
Trank1 A C 9: 111,365,559 T884P probably benign Het
Ubr3 T A 2: 70,009,162 L1540H probably damaging Het
Ugt2b37 C A 5: 87,251,880 M256I probably benign Het
Vmn2r69 G A 7: 85,415,531 T49I possibly damaging Het
Vmn2r72 T A 7: 85,737,840 I839L probably benign Het
Zcrb1 A G 15: 93,387,575 probably null Het
Zfp319 A T 8: 95,328,169 probably null Het
Zfp592 T C 7: 81,038,325 S1000P probably damaging Het
Zfp938 T C 10: 82,226,004 N261D possibly damaging Het
Zfp957 A G 14: 79,213,388 S324P unknown Het
Zswim6 G T 13: 107,726,681 noncoding transcript Het
Other mutations in Smarcd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Smarcd2 APN 11 106265904 missense probably damaging 1.00
IGL01880:Smarcd2 APN 11 106266677 missense probably damaging 1.00
R0357:Smarcd2 UTSW 11 106267332 critical splice donor site probably null
R0626:Smarcd2 UTSW 11 106267415 missense probably benign 0.10
R1524:Smarcd2 UTSW 11 106267152 missense probably benign 0.01
R1822:Smarcd2 UTSW 11 106267396 missense probably benign 0.00
R2072:Smarcd2 UTSW 11 106265307 nonsense probably null
R2074:Smarcd2 UTSW 11 106265307 nonsense probably null
R2359:Smarcd2 UTSW 11 106267164 missense probably benign 0.01
R3960:Smarcd2 UTSW 11 106266575 missense probably damaging 1.00
R4211:Smarcd2 UTSW 11 106266905 nonsense probably null
R4258:Smarcd2 UTSW 11 106265250 missense probably damaging 1.00
R4822:Smarcd2 UTSW 11 106266531 splice site probably null
R6035:Smarcd2 UTSW 11 106266889 critical splice donor site probably null
R6035:Smarcd2 UTSW 11 106266889 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCCCTAGAGAACAAGTCCAGG -3'
(R):5'- TCGTGAGTTTGGACTGTTAACC -3'

Sequencing Primer
(F):5'- ACAGTTTGGGAGAACTTGGG -3'
(R):5'- TGGACTGTTAACCTCTTAAATGGG -3'
Posted On2016-07-06