Incidental Mutation 'R0454:Prkca'
ID39907
Institutional Source Beutler Lab
Gene Symbol Prkca
Ensembl Gene ENSMUSG00000050965
Gene Nameprotein kinase C, alpha
SynonymsPkca
MMRRC Submission 038654-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R0454 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location107933387-108343928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107978280 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 69 (V69A)
Ref Sequence ENSEMBL: ENSMUSP00000097875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059595] [ENSMUST00000100302]
Predicted Effect probably benign
Transcript: ENSMUST00000059595
AA Change: V493A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000062392
Gene: ENSMUSG00000050965
AA Change: V493A

DomainStartEndE-ValueType
C1 37 86 3.09e-16 SMART
C1 102 151 1.33e-15 SMART
C2 172 275 7.66e-26 SMART
S_TKc 339 597 8.85e-98 SMART
S_TK_X 598 660 1.58e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100302
AA Change: V69A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097875
Gene: ENSMUSG00000050965
AA Change: V69A

DomainStartEndE-ValueType
Pfam:Pkinase 2 173 9.3e-44 PFAM
Pfam:Pkinase_Tyr 3 159 3.7e-25 PFAM
S_TK_X 174 236 1.58e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134910
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been reported to play roles in many different cellular processes, such as cell adhesion, cell transformation, cell cycle checkpoint, and cell volume control. Knockout studies in mice suggest that this kinase may be a fundamental regulator of cardiac contractility and Ca(2+) handling in myocytes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show no overt macroscopic abnormalities, however examination of one line revealed increased cardiac muscle contractility and protection against heart failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik A G 5: 118,255,821 E88G possibly damaging Het
4930447F04Rik T C X: 66,303,668 E91G unknown Het
Acot1 A G 12: 84,017,339 Q407R probably benign Het
Adcy10 T A 1: 165,570,728 Y1465N probably damaging Het
Ahsa2 T A 11: 23,490,702 I249F probably damaging Het
Arhgap10 T C 8: 77,250,965 N721S probably damaging Het
Arrdc4 T G 7: 68,741,871 E216A probably damaging Het
Axin1 T C 17: 26,173,663 V306A probably benign Het
BC005561 T G 5: 104,518,211 S200A probably benign Het
Cct3 T C 3: 88,302,866 probably null Het
Cfap58 G A 19: 47,974,680 probably null Het
Chd9 T C 8: 90,973,231 S49P possibly damaging Het
Clcn2 C A 16: 20,710,428 probably null Het
Col26a1 T C 5: 136,754,193 N286D probably benign Het
Cpt1b T A 15: 89,424,393 I111F possibly damaging Het
Cyp4f16 T A 17: 32,537,087 I30N probably damaging Het
Ddc T G 11: 11,880,587 D19A possibly damaging Het
Depdc1a T A 3: 159,516,900 probably null Het
Evc2 T A 5: 37,417,484 C1028S possibly damaging Het
Fam228a T C 12: 4,731,457 E134G probably damaging Het
Fasl T C 1: 161,787,954 E111G probably benign Het
Fbxw10 A G 11: 62,876,738 N800S possibly damaging Het
Fras1 T C 5: 96,762,665 S3318P probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gad1 T A 2: 70,579,201 M212K probably damaging Het
Gm17455 T G 10: 60,402,973 S6A probably benign Het
Grm5 T C 7: 88,130,789 S1146P probably damaging Het
Gsn T C 2: 35,304,639 L649P probably damaging Het
H2-DMb1 A G 17: 34,155,711 T112A probably benign Het
Hcn3 T A 3: 89,152,894 I148F probably damaging Het
Hdac10 T C 15: 89,125,758 probably null Het
Hk3 C A 13: 55,008,705 D619Y probably damaging Het
Ifi44 T A 3: 151,745,497 R272S possibly damaging Het
Il1rap A C 16: 26,698,875 D275A probably damaging Het
Itgam A T 7: 128,107,980 N660I probably benign Het
Itpr3 T C 17: 27,113,819 M1853T probably benign Het
Lrmp A G 6: 145,167,984 R293G possibly damaging Het
Lrrc8c A C 5: 105,607,099 K247Q probably damaging Het
Map3k21 T C 8: 125,942,119 S815P probably benign Het
Mast4 A G 13: 102,751,560 S1114P probably damaging Het
Myh8 C T 11: 67,303,765 Q1601* probably null Het
Nhlrc2 A G 19: 56,570,527 D148G probably damaging Het
Nos1 T A 5: 117,943,320 S1196T probably benign Het
Nsmaf C T 4: 6,424,874 probably null Het
Obscn T C 11: 58,999,623 D7361G unknown Het
Olfr1350 C T 7: 6,570,360 A123V probably damaging Het
Olfr600 C A 7: 103,346,878 A17S probably benign Het
Olfr721-ps1 T C 14: 14,407,777 V183A probably damaging Het
Pank3 T G 11: 35,777,709 M175R probably benign Het
Papolg A G 11: 23,879,868 probably null Het
Pcdhb21 G A 18: 37,514,513 D232N probably damaging Het
Pcdhb22 T C 18: 37,518,872 F131S probably damaging Het
Pik3r6 G A 11: 68,528,782 A140T possibly damaging Het
Pinlyp T C 7: 24,542,522 T87A possibly damaging Het
Pld1 T C 3: 28,124,575 S873P probably damaging Het
Pld5 T A 1: 176,274,729 Y49F probably benign Het
Polq T C 16: 37,034,890 V449A probably damaging Het
Ptk6 A G 2: 181,202,282 S75P possibly damaging Het
Ptprq G A 10: 107,582,530 Q1662* probably null Het
Ptprt C A 2: 161,553,822 A1144S probably damaging Het
Rrm1 T A 7: 102,466,926 W684R probably damaging Het
Ryr1 T A 7: 29,036,075 M4093L probably damaging Het
Scnn1a C T 6: 125,322,226 L90F probably damaging Het
Slc25a19 G T 11: 115,617,597 Y188* probably null Het
Slc31a1 C T 4: 62,385,629 probably benign Het
Slc5a11 C G 7: 123,265,235 S351R possibly damaging Het
Slc6a17 A G 3: 107,476,867 L387P probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Spam1 T A 6: 24,797,838 L331Q probably damaging Het
Spata32 A G 11: 103,209,299 W127R probably damaging Het
Spta1 T G 1: 174,213,942 I1324S probably damaging Het
St6galnac4 A G 2: 32,594,318 Y176C probably damaging Het
Stk10 A G 11: 32,596,724 E327G probably damaging Het
Stxbp5l T A 16: 37,134,284 Y912F possibly damaging Het
Tchp G A 5: 114,720,182 E459K probably benign Het
Terf2 C T 8: 107,096,210 W100* probably null Het
Thrsp T C 7: 97,417,427 N26S probably damaging Het
Tln1 C A 4: 43,553,504 R297L probably benign Het
Tmeff2 C A 1: 50,928,075 T43N possibly damaging Het
Tmx1 C T 12: 70,453,173 A2V possibly damaging Het
Tnks1bp1 T A 2: 85,072,137 L1053Q probably damaging Het
Trmt10b A T 4: 45,304,286 K107N probably damaging Het
Trpa1 A T 1: 14,885,748 probably null Het
Trrap A G 5: 144,846,477 K3371R probably damaging Het
Tuba3b G A 6: 145,618,269 V14I probably benign Het
Usp19 T C 9: 108,494,240 probably null Het
Usp28 C A 9: 49,039,101 D615E possibly damaging Het
Utp20 T C 10: 88,822,069 D43G probably benign Het
Vmn1r58 T G 7: 5,410,998 K78Q possibly damaging Het
Vmn2r10 T C 5: 109,003,461 M96V probably benign Het
Wdr90 T C 17: 25,860,049 E273G probably damaging Het
Xpc C T 6: 91,491,226 A860T probably benign Het
Zscan21 T C 5: 138,133,603 I463T possibly damaging Het
Other mutations in Prkca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Prkca APN 11 108343508 missense probably benign 0.10
IGL00903:Prkca APN 11 107983974 missense probably damaging 1.00
IGL01385:Prkca APN 11 107978352 missense probably damaging 1.00
IGL01396:Prkca APN 11 108014322 missense possibly damaging 0.59
IGL01480:Prkca APN 11 108192201 missense probably damaging 1.00
IGL01480:Prkca APN 11 107986289 missense possibly damaging 0.93
IGL01516:Prkca APN 11 107961602 missense probably null 1.00
IGL01553:Prkca APN 11 108057834 missense probably benign 0.15
IGL02975:Prkca APN 11 108340677 nonsense probably null
IGL03402:Prkca APN 11 108340663 missense probably benign 0.20
R0101:Prkca UTSW 11 108057800 missense probably damaging 1.00
R0279:Prkca UTSW 11 108054111 splice site probably benign
R0513:Prkca UTSW 11 108014376 missense possibly damaging 0.82
R0711:Prkca UTSW 11 107981654 missense probably benign 0.16
R0894:Prkca UTSW 11 108012692 missense possibly damaging 0.66
R0966:Prkca UTSW 11 108014284 missense possibly damaging 0.56
R1432:Prkca UTSW 11 107939520 missense probably benign 0.27
R1518:Prkca UTSW 11 107978316 missense probably damaging 1.00
R1667:Prkca UTSW 11 107983946 missense probably damaging 1.00
R1795:Prkca UTSW 11 108012692 missense possibly damaging 0.66
R1909:Prkca UTSW 11 107939612 missense possibly damaging 0.68
R1932:Prkca UTSW 11 108192149 missense probably benign 0.13
R2509:Prkca UTSW 11 107979206 missense probably damaging 1.00
R3889:Prkca UTSW 11 107979240 missense probably damaging 1.00
R4018:Prkca UTSW 11 107939602 missense probably damaging 1.00
R4684:Prkca UTSW 11 107961608 missense probably damaging 0.99
R5132:Prkca UTSW 11 108192117 splice site probably benign
R5298:Prkca UTSW 11 108012684 missense probably damaging 0.98
R5546:Prkca UTSW 11 108053980 missense probably benign 0.14
R5558:Prkca UTSW 11 107981647 missense probably damaging 1.00
R5616:Prkca UTSW 11 107978343 missense possibly damaging 0.85
R5626:Prkca UTSW 11 108057815 missense possibly damaging 0.94
R5931:Prkca UTSW 11 108014310 missense probably benign 0.01
R6061:Prkca UTSW 11 108057845 missense probably benign 0.03
R7125:Prkca UTSW 11 107984022 missense probably damaging 1.00
R7283:Prkca UTSW 11 108340645 critical splice donor site probably null
R7329:Prkca UTSW 11 108014277 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TACCACATGGCTGCCTCACGAATAC -3'
(R):5'- TGTCACTGAGACAAGCTAGGCAAAC -3'

Sequencing Primer
(F):5'- TGCCTCACGAATACACGGG -3'
(R):5'- GCTAGGCAAACGTCCTGATATG -3'
Posted On2013-05-23