Incidental Mutation 'R5174:Asxl3'
ID399075
Institutional Source Beutler Lab
Gene Symbol Asxl3
Ensembl Gene ENSMUSG00000045215
Gene Nameadditional sex combs like 3, transcriptional regulator
SynonymsD930044O18Rik, LOC381127, C230079D11Rik, D430002O22Rik
MMRRC Submission 042754-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.745) question?
Stock #R5174 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location22344883-22530227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22523115 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1394 (D1394V)
Ref Sequence ENSEMBL: ENSMUSP00000112793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097655] [ENSMUST00000120223]
Predicted Effect probably benign
Transcript: ENSMUST00000097655
AA Change: D1394V

PolyPhen 2 Score 0.448 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000095260
Gene: ENSMUSG00000045215
AA Change: D1394V

DomainStartEndE-ValueType
low complexity region 98 112 N/A INTRINSIC
Pfam:ASXH 173 305 5.6e-50 PFAM
low complexity region 391 404 N/A INTRINSIC
low complexity region 667 686 N/A INTRINSIC
low complexity region 939 954 N/A INTRINSIC
low complexity region 978 988 N/A INTRINSIC
low complexity region 1002 1023 N/A INTRINSIC
low complexity region 1160 1168 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1681 1691 N/A INTRINSIC
SCOP:d1dnpa2 1946 1995 6e-3 SMART
low complexity region 2035 2050 N/A INTRINSIC
Pfam:PHD_3 2139 2202 9.8e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120223
AA Change: D1394V

PolyPhen 2 Score 0.448 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112793
Gene: ENSMUSG00000045215
AA Change: D1394V

DomainStartEndE-ValueType
low complexity region 98 112 N/A INTRINSIC
Pfam:ASXH 179 304 1.3e-36 PFAM
low complexity region 391 404 N/A INTRINSIC
low complexity region 667 686 N/A INTRINSIC
low complexity region 939 954 N/A INTRINSIC
low complexity region 978 988 N/A INTRINSIC
low complexity region 1002 1023 N/A INTRINSIC
low complexity region 1160 1168 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1681 1691 N/A INTRINSIC
SCOP:d1dnpa2 1946 1995 6e-3 SMART
low complexity region 2035 2050 N/A INTRINSIC
Pfam:PHD_3 2138 2202 1.9e-24 PFAM
Meta Mutation Damage Score 0.216 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik C T 9: 103,282,556 probably null Het
Ank3 T C 10: 69,892,379 S632P probably damaging Het
Arhgef16 G A 4: 154,282,047 R451W probably damaging Het
Atp2a3 T A 11: 72,980,215 I545N probably damaging Het
Cadps2 T A 6: 23,287,743 Y1181F probably damaging Het
Camkmt C A 17: 85,452,237 F268L probably benign Het
Casp14 C T 10: 78,715,391 G20D possibly damaging Het
Celf1 T C 2: 91,001,008 C61R probably damaging Het
Cenpp CAAACCTGAAAA CAAA 13: 49,464,782 probably null Het
Cers3 A T 7: 66,784,868 K203M probably damaging Het
Clip4 T C 17: 71,810,962 F334S probably damaging Het
Cyp2b13 T A 7: 26,088,693 D415E possibly damaging Het
Decr2 A T 17: 26,087,469 probably null Het
Dmxl2 T C 9: 54,445,484 probably null Het
Dnah7b G A 1: 46,243,349 A2881T possibly damaging Het
Dnaja3 A G 16: 4,684,297 H55R probably benign Het
Dnajc11 T C 4: 151,979,984 F531L probably damaging Het
Efcab6 A G 15: 84,054,486 F10L probably benign Het
Epm2aip1 T C 9: 111,273,387 F476S probably damaging Het
Fat3 T C 9: 15,999,570 N1712S probably damaging Het
Flnc T C 6: 29,448,894 V1343A possibly damaging Het
Fsip2 C T 2: 82,980,741 P2468L probably benign Het
Gm5798 A G 14: 41,348,663 H10R possibly damaging Het
Gm7168 A G 17: 13,948,455 Y28C probably damaging Het
Gm9866 A T 12: 27,142,028 noncoding transcript Het
Gtpbp6 G A 5: 110,108,117 R19C possibly damaging Het
Gucy2e A G 11: 69,236,566 F27S probably benign Het
Krba1 A G 6: 48,412,295 E548G probably damaging Het
Ltbr A G 6: 125,309,537 S229P probably benign Het
Mgat5b A T 11: 116,977,715 Y488F probably benign Het
Mia3 T A 1: 183,331,493 K475* probably null Het
Mrpl53 C T 6: 83,109,657 T114M possibly damaging Het
Mrps35 T C 6: 147,060,211 Y195H possibly damaging Het
Muc4 A T 16: 32,751,738 I539F possibly damaging Het
Nedd1 T A 10: 92,711,212 T150S possibly damaging Het
Nox4 T G 7: 87,323,766 I327S probably benign Het
Nrk C G X: 138,986,779 A1018G probably benign Het
Olfr1152 T A 2: 87,868,411 V140E possibly damaging Het
Olfr1189 T A 2: 88,592,648 N281K probably damaging Het
Olfr608 T A 7: 103,470,403 F121L probably benign Het
Olfr984 T C 9: 40,100,747 T248A possibly damaging Het
Pdzd2 G A 15: 12,372,514 P2512S probably benign Het
Ptgis T A 2: 167,203,470 probably null Het
Rnf170 T A 8: 26,129,168 M140K probably benign Het
Scaf4 A T 16: 90,247,174 I637K unknown Het
Sdccag8 A T 1: 176,845,350 T270S probably damaging Het
Sec24d T C 3: 123,364,926 C1022R probably damaging Het
Sec63 T C 10: 42,829,081 probably benign Het
Serpinb3d C G 1: 107,078,498 E287Q possibly damaging Het
Smarcd2 A G 11: 106,267,045 probably benign Het
Sox15 A G 11: 69,655,719 Y116C probably damaging Het
Spag16 T C 1: 70,493,796 S545P probably damaging Het
Ssc5d C A 7: 4,927,971 T184N possibly damaging Het
St6galnac2 A T 11: 116,681,947 F228I probably damaging Het
Syne1 T C 10: 5,041,490 N8408S probably damaging Het
Trank1 A C 9: 111,365,559 T884P probably benign Het
Ubr3 T A 2: 70,009,162 L1540H probably damaging Het
Ugt2b37 C A 5: 87,251,880 M256I probably benign Het
Vmn2r69 G A 7: 85,415,531 T49I possibly damaging Het
Vmn2r72 T A 7: 85,737,840 I839L probably benign Het
Zcrb1 A G 15: 93,387,575 probably null Het
Zfp319 A T 8: 95,328,169 probably null Het
Zfp592 T C 7: 81,038,325 S1000P probably damaging Het
Zfp938 T C 10: 82,226,004 N261D possibly damaging Het
Zfp957 A G 14: 79,213,388 S324P unknown Het
Zswim6 G T 13: 107,726,681 noncoding transcript Het
Other mutations in Asxl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Asxl3 APN 18 22525223 missense probably benign 0.41
IGL00510:Asxl3 APN 18 22523565 missense probably damaging 1.00
IGL00864:Asxl3 APN 18 22522446 missense probably benign 0.06
IGL01074:Asxl3 APN 18 22522845 missense probably damaging 1.00
IGL01305:Asxl3 APN 18 22516446 missense probably benign 0.06
IGL01313:Asxl3 APN 18 22517459 missense probably benign 0.41
IGL01349:Asxl3 APN 18 22524237 missense probably benign 0.28
IGL01529:Asxl3 APN 18 22517655 missense probably damaging 1.00
IGL01574:Asxl3 APN 18 22523564 missense probably benign 0.06
IGL01583:Asxl3 APN 18 22516597 missense probably benign 0.01
IGL01619:Asxl3 APN 18 22523328 missense probably damaging 1.00
IGL01720:Asxl3 APN 18 22525325 missense probably damaging 1.00
IGL01816:Asxl3 APN 18 22522488 missense probably benign 0.10
IGL01828:Asxl3 APN 18 22525558 utr 3 prime probably benign
IGL01903:Asxl3 APN 18 22434576 missense probably benign 0.00
IGL01906:Asxl3 APN 18 22522281 missense probably benign 0.01
IGL01962:Asxl3 APN 18 22522445 missense probably benign 0.00
IGL01991:Asxl3 APN 18 22516162 missense probably damaging 1.00
IGL02064:Asxl3 APN 18 22524344 missense possibly damaging 0.59
IGL02187:Asxl3 APN 18 22524978 missense probably damaging 0.99
IGL02219:Asxl3 APN 18 22453626 missense possibly damaging 0.81
IGL02309:Asxl3 APN 18 22522453 missense probably benign 0.01
IGL02478:Asxl3 APN 18 22523013 missense possibly damaging 0.77
IGL02506:Asxl3 APN 18 22452399 missense probably benign 0.19
IGL02660:Asxl3 APN 18 22524345 missense probably damaging 0.98
IGL02828:Asxl3 APN 18 22524661 missense possibly damaging 0.87
IGL02863:Asxl3 APN 18 22523484 missense probably benign 0.01
IGL03001:Asxl3 APN 18 22517398 missense probably damaging 1.00
IGL03143:Asxl3 APN 18 22522974 missense probably benign 0.43
ANU22:Asxl3 UTSW 18 22516446 missense probably benign 0.06
R0145:Asxl3 UTSW 18 22453605 missense probably damaging 1.00
R0201:Asxl3 UTSW 18 22523154 missense probably benign
R0207:Asxl3 UTSW 18 22411496 splice site probably benign
R0230:Asxl3 UTSW 18 22452326 splice site probably benign
R0242:Asxl3 UTSW 18 22516681 missense possibly damaging 0.94
R0242:Asxl3 UTSW 18 22516681 missense possibly damaging 0.94
R0344:Asxl3 UTSW 18 22517611 missense probably benign 0.00
R0519:Asxl3 UTSW 18 22523520 missense possibly damaging 0.85
R0520:Asxl3 UTSW 18 22522986 missense probably damaging 0.96
R0548:Asxl3 UTSW 18 22521792 splice site probably benign
R0626:Asxl3 UTSW 18 22522880 missense probably benign 0.02
R0711:Asxl3 UTSW 18 22524451 missense probably benign 0.01
R0744:Asxl3 UTSW 18 22516040 missense probably damaging 1.00
R0833:Asxl3 UTSW 18 22516040 missense probably damaging 1.00
R1035:Asxl3 UTSW 18 22525049 missense probably damaging 1.00
R1170:Asxl3 UTSW 18 22524507 missense probably benign 0.00
R1372:Asxl3 UTSW 18 22410009 missense probably benign 0.00
R1440:Asxl3 UTSW 18 22525224 missense probably benign 0.13
R1463:Asxl3 UTSW 18 22516753 missense possibly damaging 0.94
R1471:Asxl3 UTSW 18 22516354 missense probably damaging 1.00
R1618:Asxl3 UTSW 18 22516987 missense probably damaging 1.00
R1720:Asxl3 UTSW 18 22452435 missense probably damaging 1.00
R1819:Asxl3 UTSW 18 22522376 missense probably damaging 1.00
R1824:Asxl3 UTSW 18 22522068 missense probably damaging 1.00
R1851:Asxl3 UTSW 18 22517739 missense probably damaging 0.97
R1989:Asxl3 UTSW 18 22452363 missense probably damaging 1.00
R2041:Asxl3 UTSW 18 22523451 missense probably benign 0.02
R2174:Asxl3 UTSW 18 22453644 missense possibly damaging 0.76
R2175:Asxl3 UTSW 18 22516595 missense probably benign
R2443:Asxl3 UTSW 18 22411539 missense probably benign 0.12
R2907:Asxl3 UTSW 18 22517273 missense possibly damaging 0.56
R4246:Asxl3 UTSW 18 22525500 missense probably damaging 1.00
R4254:Asxl3 UTSW 18 22524366 missense possibly damaging 0.58
R4441:Asxl3 UTSW 18 22524233 missense probably damaging 0.97
R4660:Asxl3 UTSW 18 22516477 missense probably benign 0.00
R4661:Asxl3 UTSW 18 22516477 missense probably benign 0.00
R4674:Asxl3 UTSW 18 22517738 missense probably damaging 1.00
R4749:Asxl3 UTSW 18 22516769 missense probably damaging 0.99
R4817:Asxl3 UTSW 18 22525454 missense probably damaging 0.97
R4935:Asxl3 UTSW 18 22523312 missense probably benign 0.06
R5062:Asxl3 UTSW 18 22522718 missense possibly damaging 0.92
R5064:Asxl3 UTSW 18 22516019 missense probably benign 0.00
R5065:Asxl3 UTSW 18 22525299 missense possibly damaging 0.94
R5066:Asxl3 UTSW 18 22525299 missense possibly damaging 0.94
R5067:Asxl3 UTSW 18 22525299 missense possibly damaging 0.94
R5133:Asxl3 UTSW 18 22516708 missense probably damaging 1.00
R5183:Asxl3 UTSW 18 22525299 missense possibly damaging 0.94
R5294:Asxl3 UTSW 18 22516439 missense possibly damaging 0.77
R5416:Asxl3 UTSW 18 22524494 missense probably damaging 1.00
R5587:Asxl3 UTSW 18 22525247 missense probably benign 0.28
R5873:Asxl3 UTSW 18 22516085 missense probably benign 0.04
R6240:Asxl3 UTSW 18 22465508 missense probably damaging 1.00
R6242:Asxl3 UTSW 18 22522376 missense probably damaging 1.00
R6316:Asxl3 UTSW 18 22522782 missense probably damaging 1.00
R6348:Asxl3 UTSW 18 22517273 missense possibly damaging 0.56
R6518:Asxl3 UTSW 18 22516340 missense probably damaging 0.96
R6605:Asxl3 UTSW 18 22517077 nonsense probably null
R6704:Asxl3 UTSW 18 22517305 missense probably benign 0.00
R6706:Asxl3 UTSW 18 22453609 missense probably damaging 1.00
R6786:Asxl3 UTSW 18 22525440 missense probably damaging 1.00
R6799:Asxl3 UTSW 18 22465400 nonsense probably null
R6811:Asxl3 UTSW 18 22522911 missense possibly damaging 0.87
R6817:Asxl3 UTSW 18 22523580 missense probably benign 0.00
R6830:Asxl3 UTSW 18 22525388 missense probably benign 0.45
R6957:Asxl3 UTSW 18 22522091 missense probably damaging 1.00
R7015:Asxl3 UTSW 18 22523921 missense probably benign 0.00
R7058:Asxl3 UTSW 18 22517674 missense probably damaging 1.00
R7135:Asxl3 UTSW 18 22517701 nonsense probably null
R7135:Asxl3 UTSW 18 22517702 missense probably damaging 1.00
R7231:Asxl3 UTSW 18 22411499 critical splice acceptor site probably null
R7231:Asxl3 UTSW 18 22517540 missense probably damaging 1.00
Z1088:Asxl3 UTSW 18 22516772 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGAGAAGATAGCCATGCCTGG -3'
(R):5'- GACCTAGTCTGGGAATCCAAAC -3'

Sequencing Primer
(F):5'- TGTCCATAGGTGCCACCATGAG -3'
(R):5'- GTCTGGGAATCCAAACTTGAGTCTC -3'
Posted On2016-07-06