Incidental Mutation 'R5175:Kcnn3'
ID399107
Institutional Source Beutler Lab
Gene Symbol Kcnn3
Ensembl Gene ENSMUSG00000000794
Gene Namepotassium intermediate/small conductance calcium-activated channel, subfamily N, member 3
Synonymssmall conductance calcium-activated potassium channel 3, SK3
MMRRC Submission 042755-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.445) question?
Stock #R5175 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location89520164-89675132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89609439 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 385 (F385S)
Ref Sequence ENSEMBL: ENSMUSP00000000811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000811]
Predicted Effect probably damaging
Transcript: ENSMUST00000000811
AA Change: F385S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000811
Gene: ENSMUSG00000000794
AA Change: F385S

DomainStartEndE-ValueType
low complexity region 30 96 N/A INTRINSIC
low complexity region 139 154 N/A INTRINSIC
low complexity region 213 224 N/A INTRINSIC
Pfam:SK_channel 270 383 3.1e-51 PFAM
Pfam:Ion_trans_2 462 548 2.2e-14 PFAM
CaMBD 562 638 1.04e-49 SMART
low complexity region 684 690 N/A INTRINSIC
low complexity region 718 731 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. This gene belongs to the KCNN family of potassium channels. It encodes an integral membrane protein that forms a voltage-independent calcium-activated channel, which is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene contains two CAG repeat regions in the coding sequence. It was thought that expansion of one or both of these repeats could lead to an increased susceptibility to schizophrenia or bipolar disorder, but studies indicate that this is probably not the case. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for an insertion of a tetracycline-regulated gene switch display no overt phenotype when expression is abolished by doxycycline treatment; in contrast, untreated homozygotes show abnormal respiratory responses to hypoxia, impaired parturition, and pregnancy-related premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr2 A C 11: 20,080,114 M215R probably benign Het
Ago2 A T 15: 73,124,218 I354K possibly damaging Het
Angel2 T A 1: 190,940,884 C72* probably null Het
Ank2 T A 3: 127,004,024 H679L probably damaging Het
Anks1 A T 17: 28,042,588 Q694L probably damaging Het
Aox3 C T 1: 58,172,328 P1015S probably benign Het
Arhgap35 C A 7: 16,562,599 R847L probably damaging Het
Bag4 C A 8: 25,768,351 C316F probably damaging Het
Camkv T A 9: 107,947,382 I258N probably damaging Het
Cpt1c G A 7: 44,971,357 A28V probably damaging Het
Cyp2j13 A T 4: 96,068,215 M219K possibly damaging Het
Dclk1 G T 3: 55,247,227 R26L possibly damaging Het
Diras2 A T 13: 52,507,971 I100N probably damaging Het
Dnah5 T A 15: 28,448,404 N4204K probably damaging Het
Dnase1l3 T A 14: 7,987,386 K55* probably null Het
Dusp6 A G 10: 99,264,002 D104G possibly damaging Het
Eif5b A G 1: 38,045,387 T819A probably damaging Het
Elfn2 A T 15: 78,673,873 L158H probably damaging Het
Erp44 T C 4: 48,196,823 T367A probably benign Het
Fasn A T 11: 120,816,369 D843E probably benign Het
Fbxw25 T C 9: 109,664,563 Y20C probably damaging Het
Fer1l6 G A 15: 58,550,277 G108E probably damaging Het
Fndc7 C T 3: 108,869,166 V520I probably benign Het
Gm17019 A G 5: 15,032,803 W46R possibly damaging Het
Gorab G T 1: 163,386,645 Q239K probably damaging Het
Gsdma2 A G 11: 98,652,612 T76A probably benign Het
Hnrnpll A C 17: 80,034,070 C513W possibly damaging Het
Ifrd2 T C 9: 107,590,625 L170P probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnma1 A G 14: 23,336,038 probably null Het
Kif18a T G 2: 109,302,978 probably null Het
Llgl2 A G 11: 115,850,721 K559R probably damaging Het
Lrrc8a T C 2: 30,255,512 C113R probably damaging Het
Mgat5 A G 1: 127,459,912 N535S probably damaging Het
Myh15 T G 16: 49,069,426 W127G possibly damaging Het
Npsr1 A G 9: 24,134,815 R77G probably benign Het
Nub1 T A 5: 24,702,448 S376R probably benign Het
Olfr1040 T C 2: 86,145,957 Y259C probably damaging Het
Olfr1297 A T 2: 111,621,426 I216N possibly damaging Het
Olfr1426 G A 19: 12,088,562 P77S probably damaging Het
Olfr1501 G A 19: 13,838,316 P286S probably damaging Het
Olfr301 T C 7: 86,413,046 V228A probably benign Het
Pcdh9 A G 14: 93,888,443 L97P probably damaging Het
Pkn2 A G 3: 142,798,923 Y831H probably damaging Het
Plcz1 T G 6: 140,039,663 I51L possibly damaging Het
Plekhg1 T C 10: 3,965,516 probably benign Het
Prdm9 A T 17: 15,557,451 S124T probably benign Het
Prkag1 A C 15: 98,815,715 V33G possibly damaging Het
Rab25 T A 3: 88,543,421 Y57F possibly damaging Het
Rb1cc1 A G 1: 6,248,321 I638V probably benign Het
Rest C A 5: 77,268,372 D144E probably damaging Het
Rpa2 A G 4: 132,777,840 D260G probably damaging Het
Sf3b3 A G 8: 110,833,835 V425A probably benign Het
Sidt2 A T 9: 45,951,788 M15K probably damaging Het
Slc22a17 A G 14: 54,907,291 L555P probably damaging Het
Smoc2 A G 17: 14,375,457 D282G possibly damaging Het
Sorcs3 G A 19: 48,759,845 probably null Het
Srcin1 A G 11: 97,573,877 W15R probably damaging Het
Stra6l A G 4: 45,870,860 T259A probably benign Het
Thegl C T 5: 77,016,470 P107S probably benign Het
Ube3a T C 7: 59,288,717 F741S probably damaging Het
Vasp C A 7: 19,264,669 M54I probably benign Het
Vmn1r174 A T 7: 23,754,728 H273L probably benign Het
Vmn2r50 T A 7: 10,037,717 I686F probably damaging Het
Vmn2r76 T C 7: 86,228,707 E494G probably benign Het
Zfp788 A G 7: 41,649,329 E443G probably damaging Het
Other mutations in Kcnn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02263:Kcnn3 APN 3 89661218 missense possibly damaging 0.73
IGL02444:Kcnn3 APN 3 89652052 missense possibly damaging 0.50
IGL02500:Kcnn3 APN 3 89661112 splice site probably benign
IGL02814:Kcnn3 APN 3 89521175 missense possibly damaging 0.94
IGL02821:Kcnn3 APN 3 89662722 missense possibly damaging 0.84
IGL02821:Kcnn3 APN 3 89520974 missense possibly damaging 0.91
IGL02852:Kcnn3 APN 3 89609616 missense probably damaging 0.96
IGL02942:Kcnn3 APN 3 89652076 missense probably benign 0.00
IGL03118:Kcnn3 APN 3 89667161 missense probably damaging 1.00
R0015:Kcnn3 UTSW 3 89662773 missense probably damaging 1.00
R0015:Kcnn3 UTSW 3 89662773 missense probably damaging 1.00
R0032:Kcnn3 UTSW 3 89520665 small deletion probably benign
R0370:Kcnn3 UTSW 3 89667092 missense probably damaging 0.98
R0619:Kcnn3 UTSW 3 89652030 missense probably damaging 1.00
R1167:Kcnn3 UTSW 3 89564952 nonsense probably null
R1255:Kcnn3 UTSW 3 89652109 missense possibly damaging 0.84
R1643:Kcnn3 UTSW 3 89520497 missense unknown
R1733:Kcnn3 UTSW 3 89652090 missense probably benign 0.00
R1793:Kcnn3 UTSW 3 89609405 missense probably benign 0.20
R1827:Kcnn3 UTSW 3 89520994 missense possibly damaging 0.75
R1899:Kcnn3 UTSW 3 89520455 start gained probably benign
R2055:Kcnn3 UTSW 3 89521375 missense probably damaging 1.00
R2843:Kcnn3 UTSW 3 89520665 small deletion probably benign
R2922:Kcnn3 UTSW 3 89521022 missense probably damaging 1.00
R4078:Kcnn3 UTSW 3 89661188 missense possibly damaging 0.68
R4227:Kcnn3 UTSW 3 89521175 missense possibly damaging 0.94
R4604:Kcnn3 UTSW 3 89520420 start gained probably benign
R4814:Kcnn3 UTSW 3 89662724 missense probably damaging 1.00
R4822:Kcnn3 UTSW 3 89667289 missense possibly damaging 0.93
R5211:Kcnn3 UTSW 3 89521231 missense probably benign 0.04
R5438:Kcnn3 UTSW 3 89521298 missense probably damaging 1.00
R5496:Kcnn3 UTSW 3 89609490 missense possibly damaging 0.95
R6244:Kcnn3 UTSW 3 89645523 nonsense probably null
R7391:Kcnn3 UTSW 3 89609471 missense probably benign 0.34
Z1088:Kcnn3 UTSW 3 89667130 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCACACAGGTAGGCTCCTAG -3'
(R):5'- TTGATCTTGTTGAGGGCCCC -3'

Sequencing Primer
(F):5'- TGGTCAGGCTCTTGGACC -3'
(R):5'- TTGAGGGCCCCGATGCTTC -3'
Posted On2016-07-06