Incidental Mutation 'R5175:Ank2'
ID399111
Institutional Source Beutler Lab
Gene Symbol Ank2
Ensembl Gene ENSMUSG00000032826
Gene Nameankyrin 2, brain
SynonymsAnkyrin-B, Ank-2, Ankyrin-2, Gm4392, ankyrin B
MMRRC Submission 042755-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5175 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location126921612-127499350 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127004024 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 679 (H679L)
Ref Sequence ENSEMBL: ENSMUSP00000138251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182064] [ENSMUST00000182078] [ENSMUST00000182711] [ENSMUST00000182959]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104429
Predicted Effect possibly damaging
Transcript: ENSMUST00000182064
AA Change: H700L

PolyPhen 2 Score 0.530 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138620
Gene: ENSMUSG00000032826
AA Change: H700L

DomainStartEndE-ValueType
ANK 9 38 1e1 SMART
ANK 42 71 8.9e-7 SMART
ANK 75 104 4.4e-9 SMART
ANK 108 137 2.8e-9 SMART
ANK 141 169 5.3e-1 SMART
ANK 170 199 7.3e-1 SMART
ANK 211 240 1.1e-7 SMART
ANK 244 273 4.4e-9 SMART
ANK 277 306 9.3e-8 SMART
ANK 310 339 2.1e-8 SMART
ANK 343 372 1.3e-7 SMART
ANK 376 405 6.2e-9 SMART
ANK 409 438 1.1e-7 SMART
ANK 442 471 2.9e-8 SMART
ANK 475 504 1.1e-5 SMART
ANK 508 537 6.5e-6 SMART
ANK 541 570 2.3e-7 SMART
ANK 574 603 2.4e-7 SMART
ANK 607 636 3.2e-9 SMART
ANK 640 669 5.5e-5 SMART
ANK 673 702 1.9e-8 SMART
ANK 706 735 3.3e-9 SMART
low complexity region 755 775 N/A INTRINSIC
low complexity region 793 806 N/A INTRINSIC
low complexity region 841 853 N/A INTRINSIC
ZU5 912 1016 2e-63 SMART
low complexity region 1371 1381 N/A INTRINSIC
low complexity region 1448 1463 N/A INTRINSIC
low complexity region 1490 1503 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182078
AA Change: H646L

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000138753
Gene: ENSMUSG00000032826
AA Change: H646L

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
low complexity region 114 125 N/A INTRINSIC
low complexity region 191 209 N/A INTRINSIC
low complexity region 304 312 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
low complexity region 527 544 N/A INTRINSIC
DEATH 591 685 1e-29 SMART
low complexity region 720 736 N/A INTRINSIC
low complexity region 848 861 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182711
AA Change: H696L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138781
Gene: ENSMUSG00000032826
AA Change: H696L

DomainStartEndE-ValueType
ANK 26 55 1e1 SMART
ANK 59 88 8.9e-7 SMART
ANK 92 121 4.4e-9 SMART
ANK 125 154 2.8e-9 SMART
ANK 158 186 5.3e-1 SMART
ANK 187 216 7.3e-1 SMART
ANK 228 257 1.1e-7 SMART
ANK 261 290 4.4e-9 SMART
ANK 294 323 9.3e-8 SMART
ANK 327 356 2.1e-8 SMART
ANK 360 389 1.3e-7 SMART
ANK 393 422 6.2e-9 SMART
ANK 426 455 1.1e-7 SMART
ANK 459 488 2.9e-8 SMART
ANK 492 521 1.1e-5 SMART
ANK 525 554 6.5e-6 SMART
ANK 558 587 2.3e-7 SMART
ANK 591 620 5.3e-7 SMART
ANK 624 653 2.4e-7 SMART
ANK 657 686 3.2e-9 SMART
ANK 690 719 5.5e-5 SMART
ANK 723 752 1.9e-8 SMART
ANK 756 785 3.3e-9 SMART
low complexity region 805 825 N/A INTRINSIC
low complexity region 843 856 N/A INTRINSIC
ZU5 961 1098 1.1e-50 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182959
AA Change: H679L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138251
Gene: ENSMUSG00000032826
AA Change: H679L

DomainStartEndE-ValueType
ANK 9 38 1.63e3 SMART
ANK 42 71 1.4e-4 SMART
ANK 75 104 6.76e-7 SMART
ANK 108 137 4.46e-7 SMART
ANK 141 169 8.36e1 SMART
ANK 170 199 1.17e2 SMART
ANK 211 240 1.76e-5 SMART
ANK 244 273 6.76e-7 SMART
ANK 277 306 1.43e-5 SMART
ANK 310 339 3.33e-6 SMART
ANK 343 372 2.02e-5 SMART
ANK 376 405 9.55e-7 SMART
ANK 409 438 1.76e-5 SMART
ANK 442 471 4.71e-6 SMART
ANK 475 504 1.7e-3 SMART
ANK 508 537 1.05e-3 SMART
ANK 541 570 3.51e-5 SMART
ANK 574 603 8.65e-5 SMART
ANK 607 636 3.76e-5 SMART
ANK 640 669 5.12e-7 SMART
ANK 673 702 8.39e-3 SMART
ANK 706 735 2.9e-6 SMART
ANK 739 768 5.12e-7 SMART
low complexity region 788 808 N/A INTRINSIC
low complexity region 826 839 N/A INTRINSIC
low complexity region 874 886 N/A INTRINSIC
Pfam:ZU5 945 1028 1.5e-30 PFAM
Pfam:ZU5 1021 1082 4.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199027
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in death by postnatal day 8, although some animals survive to P20. Mutant animals display reduced body size, impaired balance and locomotion, brain structure dysmorphologies, abnormal lens, and optic nerve degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr2 A C 11: 20,080,114 M215R probably benign Het
Ago2 A T 15: 73,124,218 I354K possibly damaging Het
Angel2 T A 1: 190,940,884 C72* probably null Het
Anks1 A T 17: 28,042,588 Q694L probably damaging Het
Aox3 C T 1: 58,172,328 P1015S probably benign Het
Arhgap35 C A 7: 16,562,599 R847L probably damaging Het
Bag4 C A 8: 25,768,351 C316F probably damaging Het
Camkv T A 9: 107,947,382 I258N probably damaging Het
Cpt1c G A 7: 44,971,357 A28V probably damaging Het
Cyp2j13 A T 4: 96,068,215 M219K possibly damaging Het
Dclk1 G T 3: 55,247,227 R26L possibly damaging Het
Diras2 A T 13: 52,507,971 I100N probably damaging Het
Dnah5 T A 15: 28,448,404 N4204K probably damaging Het
Dnase1l3 T A 14: 7,987,386 K55* probably null Het
Dusp6 A G 10: 99,264,002 D104G possibly damaging Het
Eif5b A G 1: 38,045,387 T819A probably damaging Het
Elfn2 A T 15: 78,673,873 L158H probably damaging Het
Erp44 T C 4: 48,196,823 T367A probably benign Het
Fasn A T 11: 120,816,369 D843E probably benign Het
Fbxw25 T C 9: 109,664,563 Y20C probably damaging Het
Fer1l6 G A 15: 58,550,277 G108E probably damaging Het
Fndc7 C T 3: 108,869,166 V520I probably benign Het
Gm17019 A G 5: 15,032,803 W46R possibly damaging Het
Gorab G T 1: 163,386,645 Q239K probably damaging Het
Gsdma2 A G 11: 98,652,612 T76A probably benign Het
Hnrnpll A C 17: 80,034,070 C513W possibly damaging Het
Ifrd2 T C 9: 107,590,625 L170P probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnma1 A G 14: 23,336,038 probably null Het
Kcnn3 T C 3: 89,609,439 F385S probably damaging Het
Kif18a T G 2: 109,302,978 probably null Het
Llgl2 A G 11: 115,850,721 K559R probably damaging Het
Lrrc8a T C 2: 30,255,512 C113R probably damaging Het
Mgat5 A G 1: 127,459,912 N535S probably damaging Het
Myh15 T G 16: 49,069,426 W127G possibly damaging Het
Npsr1 A G 9: 24,134,815 R77G probably benign Het
Nub1 T A 5: 24,702,448 S376R probably benign Het
Olfr1040 T C 2: 86,145,957 Y259C probably damaging Het
Olfr1297 A T 2: 111,621,426 I216N possibly damaging Het
Olfr1426 G A 19: 12,088,562 P77S probably damaging Het
Olfr1501 G A 19: 13,838,316 P286S probably damaging Het
Olfr301 T C 7: 86,413,046 V228A probably benign Het
Pcdh9 A G 14: 93,888,443 L97P probably damaging Het
Pkn2 A G 3: 142,798,923 Y831H probably damaging Het
Plcz1 T G 6: 140,039,663 I51L possibly damaging Het
Plekhg1 T C 10: 3,965,516 probably benign Het
Prdm9 A T 17: 15,557,451 S124T probably benign Het
Prkag1 A C 15: 98,815,715 V33G possibly damaging Het
Rab25 T A 3: 88,543,421 Y57F possibly damaging Het
Rb1cc1 A G 1: 6,248,321 I638V probably benign Het
Rest C A 5: 77,268,372 D144E probably damaging Het
Rpa2 A G 4: 132,777,840 D260G probably damaging Het
Sf3b3 A G 8: 110,833,835 V425A probably benign Het
Sidt2 A T 9: 45,951,788 M15K probably damaging Het
Slc22a17 A G 14: 54,907,291 L555P probably damaging Het
Smoc2 A G 17: 14,375,457 D282G possibly damaging Het
Sorcs3 G A 19: 48,759,845 probably null Het
Srcin1 A G 11: 97,573,877 W15R probably damaging Het
Stra6l A G 4: 45,870,860 T259A probably benign Het
Thegl C T 5: 77,016,470 P107S probably benign Het
Ube3a T C 7: 59,288,717 F741S probably damaging Het
Vasp C A 7: 19,264,669 M54I probably benign Het
Vmn1r174 A T 7: 23,754,728 H273L probably benign Het
Vmn2r50 T A 7: 10,037,717 I686F probably damaging Het
Vmn2r76 T C 7: 86,228,707 E494G probably benign Het
Zfp788 A G 7: 41,649,329 E443G probably damaging Het
Other mutations in Ank2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01298:Ank2 APN 3 126959720 missense possibly damaging 0.80
IGL01652:Ank2 APN 3 126933041 missense probably benign 0.00
IGL01969:Ank2 APN 3 126953223 missense possibly damaging 0.47
IGL02122:Ank2 APN 3 126937874 splice site probably benign
IGL02537:Ank2 APN 3 126955916 missense probably damaging 1.00
IGL02858:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL02981:Ank2 APN 3 126934562 missense possibly damaging 0.58
IGL02981:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03024:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03074:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03111:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03129:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03174:Ank2 APN 3 126940095 missense probably damaging 0.98
IGL03177:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03185:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03188:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03242:Ank2 APN 3 126928805 missense possibly damaging 0.90
IGL03244:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03248:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03285:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03304:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03358:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03380:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03389:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03400:Ank2 APN 3 126955870 missense probably damaging 1.00
IGL03409:Ank2 APN 3 126955870 missense probably damaging 1.00
R0033:Ank2 UTSW 3 127104748 splice site probably benign
R0042:Ank2 UTSW 3 126936631 missense probably damaging 0.99
R0042:Ank2 UTSW 3 126936631 missense probably damaging 0.99
R0079:Ank2 UTSW 3 126934615 missense probably benign 0.01
R0423:Ank2 UTSW 3 126929860 nonsense probably null
R0699:Ank2 UTSW 3 126929829 missense probably benign 0.00
R0724:Ank2 UTSW 3 126962337 missense probably damaging 1.00
R0990:Ank2 UTSW 3 126934666 missense possibly damaging 0.64
R1450:Ank2 UTSW 3 126957302 missense possibly damaging 0.94
R1500:Ank2 UTSW 3 126932982 missense probably benign
R1702:Ank2 UTSW 3 126955899 missense probably benign 0.00
R1703:Ank2 UTSW 3 126929766 missense probably damaging 1.00
R1710:Ank2 UTSW 3 126933060 nonsense probably null
R1743:Ank2 UTSW 3 126928675 missense probably damaging 0.99
R1775:Ank2 UTSW 3 126934547 missense probably benign 0.00
R1852:Ank2 UTSW 3 126997851 critical splice donor site probably null
R2198:Ank2 UTSW 3 126934577 missense possibly damaging 0.73
R2892:Ank2 UTSW 3 127248243 splice site probably null
R2893:Ank2 UTSW 3 127248243 splice site probably null
R2894:Ank2 UTSW 3 127248243 splice site probably null
R3148:Ank2 UTSW 3 126933075 missense probably benign 0.00
R3776:Ank2 UTSW 3 126942262 intron probably benign
R3784:Ank2 UTSW 3 126953193 missense probably damaging 1.00
R3856:Ank2 UTSW 3 126929844 missense probably benign 0.00
R3906:Ank2 UTSW 3 127016898 missense probably damaging 1.00
R3907:Ank2 UTSW 3 127016898 missense probably damaging 1.00
R3953:Ank2 UTSW 3 126988160 missense probably damaging 1.00
R3963:Ank2 UTSW 3 126934596 missense probably benign
R4367:Ank2 UTSW 3 126946149 missense probably benign
R4414:Ank2 UTSW 3 127225762 critical splice donor site probably null
R4432:Ank2 UTSW 3 126947806 intron probably benign
R4433:Ank2 UTSW 3 126947806 intron probably benign
R4579:Ank2 UTSW 3 126958963 missense probably damaging 1.00
R4597:Ank2 UTSW 3 126988151 missense probably damaging 1.00
R4603:Ank2 UTSW 3 127032016 missense probably benign 0.00
R4729:Ank2 UTSW 3 126976896 nonsense probably null
R4815:Ank2 UTSW 3 126936761 missense probably benign
R4826:Ank2 UTSW 3 126956001 missense probably benign 0.35
R4871:Ank2 UTSW 3 126959795 missense probably damaging 1.00
R4880:Ank2 UTSW 3 127046826 splice site probably null
R4915:Ank2 UTSW 3 126942671 intron probably benign
R4935:Ank2 UTSW 3 126956064 missense probably damaging 1.00
R4936:Ank2 UTSW 3 126955039 missense possibly damaging 0.94
R4937:Ank2 UTSW 3 126962401 missense probably damaging 1.00
R4946:Ank2 UTSW 3 126941940 intron probably benign
R4963:Ank2 UTSW 3 127032096 missense probably benign 0.01
R4989:Ank2 UTSW 3 126963445 missense possibly damaging 0.94
R5023:Ank2 UTSW 3 126941871 intron probably benign
R5060:Ank2 UTSW 3 126945921 intron probably benign
R5078:Ank2 UTSW 3 126942353 intron probably benign
R5086:Ank2 UTSW 3 126947348 intron probably benign
R5134:Ank2 UTSW 3 126963445 missense possibly damaging 0.94
R5148:Ank2 UTSW 3 127025636 intron probably null
R5275:Ank2 UTSW 3 127032183 missense probably damaging 1.00
R5295:Ank2 UTSW 3 127032183 missense probably damaging 1.00
R5303:Ank2 UTSW 3 126945804 intron probably benign
R5309:Ank2 UTSW 3 126959768 missense probably damaging 0.99
R5312:Ank2 UTSW 3 126959768 missense probably damaging 0.99
R5352:Ank2 UTSW 3 127498991 utr 5 prime probably benign
R5355:Ank2 UTSW 3 126944049 intron probably benign
R5386:Ank2 UTSW 3 126981933 missense probably benign 0.01
R5396:Ank2 UTSW 3 126953226 missense probably damaging 1.00
R5518:Ank2 UTSW 3 126959699 missense probably damaging 0.98
R5534:Ank2 UTSW 3 126947298 intron probably benign
R5554:Ank2 UTSW 3 126998973 missense possibly damaging 0.78
R5582:Ank2 UTSW 3 126946305 intron probably benign
R5747:Ank2 UTSW 3 126941751 intron probably benign
R5794:Ank2 UTSW 3 126930020 missense probably benign 0.00
R5831:Ank2 UTSW 3 127339159 start gained probably benign
R5925:Ank2 UTSW 3 126932963 missense probably benign 0.18
R5954:Ank2 UTSW 3 126997861 missense probably benign 0.34
R5956:Ank2 UTSW 3 126942688 intron probably benign
R5986:Ank2 UTSW 3 127012686 missense possibly damaging 0.94
R5992:Ank2 UTSW 3 126959651 critical splice donor site probably null
R6020:Ank2 UTSW 3 126946821 intron probably benign
R6027:Ank2 UTSW 3 126997879 missense possibly damaging 0.92
R6049:Ank2 UTSW 3 126943020 missense possibly damaging 0.95
R6060:Ank2 UTSW 3 126955952 missense probably damaging 1.00
R6114:Ank2 UTSW 3 127011051 missense probably damaging 1.00
R6124:Ank2 UTSW 3 127248151 missense probably benign 0.31
R6156:Ank2 UTSW 3 126944237 missense probably damaging 1.00
R6173:Ank2 UTSW 3 127052746 missense probably damaging 1.00
R6176:Ank2 UTSW 3 126945471 missense probably benign 0.05
R6184:Ank2 UTSW 3 126962398 missense probably damaging 1.00
R6199:Ank2 UTSW 3 127004006 missense probably damaging 1.00
R6241:Ank2 UTSW 3 127052748 missense probably damaging 1.00
R6254:Ank2 UTSW 3 126941804 intron probably benign
R6259:Ank2 UTSW 3 127016986 missense probably benign 0.28
R6260:Ank2 UTSW 3 126943557 missense probably benign
R6321:Ank2 UTSW 3 126946938 intron probably benign
R6393:Ank2 UTSW 3 126929757 missense probably damaging 1.00
R6406:Ank2 UTSW 3 127032225 missense probably damaging 1.00
R6544:Ank2 UTSW 3 126933222 missense probably damaging 0.99
R6583:Ank2 UTSW 3 127016964 missense probably damaging 1.00
R6739:Ank2 UTSW 3 127079994 missense probably damaging 1.00
R6754:Ank2 UTSW 3 127096839 intron probably benign
R6786:Ank2 UTSW 3 126958932 missense probably damaging 0.99
R6798:Ank2 UTSW 3 126944264 intron probably benign
R6882:Ank2 UTSW 3 126945757 intron probably benign
R6940:Ank2 UTSW 3 126941972 intron probably benign
R6949:Ank2 UTSW 3 127010884 missense probably benign 0.00
R7001:Ank2 UTSW 3 127077581 missense probably damaging 1.00
R7033:Ank2 UTSW 3 126944850 nonsense probably null
R7036:Ank2 UTSW 3 126946392 intron probably benign
R7045:Ank2 UTSW 3 127012744 missense probably damaging 1.00
R7048:Ank2 UTSW 3 127025618 missense probably benign 0.03
R7054:Ank2 UTSW 3 126943303 intron probably benign
R7069:Ank2 UTSW 3 126946298 intron probably benign
R7091:Ank2 UTSW 3 127023351 missense probably damaging 0.98
R7107:Ank2 UTSW 3 127003982 missense probably damaging 1.00
Z1088:Ank2 UTSW 3 127029509 missense possibly damaging 0.45
Predicted Primers PCR Primer
(F):5'- TAACGGACCCAGGGAATCATG -3'
(R):5'- GAGTAGGTCTTGGCTGAAAACTC -3'

Sequencing Primer
(F):5'- CATGGGAAAGCTTAGACTTTAGAATG -3'
(R):5'- GGTCTTGGCTGAAAACTCATATTTAC -3'
Posted On2016-07-06