Incidental Mutation 'R5175:Nub1'
ID399130
Institutional Source Beutler Lab
Gene Symbol Nub1
Ensembl Gene ENSMUSG00000028954
Gene Namenegative regulator of ubiquitin-like proteins 1
SynonymsNY-REN-18, 4931404D21Rik, 6330412F12Rik, BS4
MMRRC Submission 042755-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.872) question?
Stock #R5175 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location24685532-24710378 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24702448 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 376 (S376R)
Ref Sequence ENSEMBL: ENSMUSP00000143657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068825] [ENSMUST00000197407]
Predicted Effect probably benign
Transcript: ENSMUST00000068825
AA Change: S352R

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000070265
Gene: ENSMUSG00000028954
AA Change: S352R

DomainStartEndE-ValueType
coiled coil region 37 70 N/A INTRINSIC
PDB:1WJU|A 71 162 2e-45 PDB
low complexity region 167 186 N/A INTRINSIC
UBA 375 412 7.29e-8 SMART
UBA 431 468 1.61e-9 SMART
UBA 490 527 1.95e-8 SMART
low complexity region 539 565 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181925
Predicted Effect probably benign
Transcript: ENSMUST00000197407
AA Change: S376R

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143657
Gene: ENSMUSG00000028954
AA Change: S376R

DomainStartEndE-ValueType
coiled coil region 61 94 N/A INTRINSIC
PDB:1WJU|A 95 186 2e-45 PDB
low complexity region 191 210 N/A INTRINSIC
UBA 399 436 3.5e-10 SMART
UBA 455 492 8.1e-12 SMART
UBA 514 551 9.5e-11 SMART
low complexity region 563 589 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200337
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a negative regulator of NEDD8, a ubiquitin-like protein that conjugates with cullin family members in order to regulate vital biological events. The protein encoded by this gene regulates the NEDD8 conjugation system post-transcriptionally by recruiting NEDD8 and its conjugates to the proteasome for degradation. This protein interacts with the product of the AIPL1 gene, which is associated with Leber congenital amaurosis, an inherited retinopathy, and mutations in that gene can abolish interaction with this protein, which may contribute to the pathogenesis. This protein is also known to accumulate in Lewy bodies in Parkinson's disease and dementia with Lewy bodies, and in glial cytoplasmic inclusions in multiple system atrophy, with this abnormal accumulation being specific to alpha-synucleinopathy lesions. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr2 A C 11: 20,080,114 M215R probably benign Het
Ago2 A T 15: 73,124,218 I354K possibly damaging Het
Angel2 T A 1: 190,940,884 C72* probably null Het
Ank2 T A 3: 127,004,024 H679L probably damaging Het
Anks1 A T 17: 28,042,588 Q694L probably damaging Het
Aox3 C T 1: 58,172,328 P1015S probably benign Het
Arhgap35 C A 7: 16,562,599 R847L probably damaging Het
Bag4 C A 8: 25,768,351 C316F probably damaging Het
Camkv T A 9: 107,947,382 I258N probably damaging Het
Cpt1c G A 7: 44,971,357 A28V probably damaging Het
Cyp2j13 A T 4: 96,068,215 M219K possibly damaging Het
Dclk1 G T 3: 55,247,227 R26L possibly damaging Het
Diras2 A T 13: 52,507,971 I100N probably damaging Het
Dnah5 T A 15: 28,448,404 N4204K probably damaging Het
Dnase1l3 T A 14: 7,987,386 K55* probably null Het
Dusp6 A G 10: 99,264,002 D104G possibly damaging Het
Eif5b A G 1: 38,045,387 T819A probably damaging Het
Elfn2 A T 15: 78,673,873 L158H probably damaging Het
Erp44 T C 4: 48,196,823 T367A probably benign Het
Fasn A T 11: 120,816,369 D843E probably benign Het
Fbxw25 T C 9: 109,664,563 Y20C probably damaging Het
Fer1l6 G A 15: 58,550,277 G108E probably damaging Het
Fndc7 C T 3: 108,869,166 V520I probably benign Het
Gm17019 A G 5: 15,032,803 W46R possibly damaging Het
Gorab G T 1: 163,386,645 Q239K probably damaging Het
Gsdma2 A G 11: 98,652,612 T76A probably benign Het
Hnrnpll A C 17: 80,034,070 C513W possibly damaging Het
Ifrd2 T C 9: 107,590,625 L170P probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnma1 A G 14: 23,336,038 probably null Het
Kcnn3 T C 3: 89,609,439 F385S probably damaging Het
Kif18a T G 2: 109,302,978 probably null Het
Llgl2 A G 11: 115,850,721 K559R probably damaging Het
Lrrc8a T C 2: 30,255,512 C113R probably damaging Het
Mgat5 A G 1: 127,459,912 N535S probably damaging Het
Myh15 T G 16: 49,069,426 W127G possibly damaging Het
Npsr1 A G 9: 24,134,815 R77G probably benign Het
Olfr1040 T C 2: 86,145,957 Y259C probably damaging Het
Olfr1297 A T 2: 111,621,426 I216N possibly damaging Het
Olfr1426 G A 19: 12,088,562 P77S probably damaging Het
Olfr1501 G A 19: 13,838,316 P286S probably damaging Het
Olfr301 T C 7: 86,413,046 V228A probably benign Het
Pcdh9 A G 14: 93,888,443 L97P probably damaging Het
Pkn2 A G 3: 142,798,923 Y831H probably damaging Het
Plcz1 T G 6: 140,039,663 I51L possibly damaging Het
Plekhg1 T C 10: 3,965,516 probably benign Het
Prdm9 A T 17: 15,557,451 S124T probably benign Het
Prkag1 A C 15: 98,815,715 V33G possibly damaging Het
Rab25 T A 3: 88,543,421 Y57F possibly damaging Het
Rb1cc1 A G 1: 6,248,321 I638V probably benign Het
Rest C A 5: 77,268,372 D144E probably damaging Het
Rpa2 A G 4: 132,777,840 D260G probably damaging Het
Sf3b3 A G 8: 110,833,835 V425A probably benign Het
Sidt2 A T 9: 45,951,788 M15K probably damaging Het
Slc22a17 A G 14: 54,907,291 L555P probably damaging Het
Smoc2 A G 17: 14,375,457 D282G possibly damaging Het
Sorcs3 G A 19: 48,759,845 probably null Het
Srcin1 A G 11: 97,573,877 W15R probably damaging Het
Stra6l A G 4: 45,870,860 T259A probably benign Het
Thegl C T 5: 77,016,470 P107S probably benign Het
Ube3a T C 7: 59,288,717 F741S probably damaging Het
Vasp C A 7: 19,264,669 M54I probably benign Het
Vmn1r174 A T 7: 23,754,728 H273L probably benign Het
Vmn2r50 T A 7: 10,037,717 I686F probably damaging Het
Vmn2r76 T C 7: 86,228,707 E494G probably benign Het
Zfp788 A G 7: 41,649,329 E443G probably damaging Het
Other mutations in Nub1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02367:Nub1 APN 5 24689394 start codon destroyed probably null 0.99
IGL02626:Nub1 APN 5 24703464 missense possibly damaging 0.65
IGL02629:Nub1 APN 5 24703464 missense possibly damaging 0.65
IGL02633:Nub1 APN 5 24692933 missense probably benign 0.00
IGL02798:Nub1 APN 5 24692814 missense probably damaging 1.00
IGL03384:Nub1 APN 5 24697427 splice site probably benign
IGL03384:Nub1 APN 5 24697426 splice site probably null
R2484:Nub1 UTSW 5 24708702 missense possibly damaging 0.91
R2679:Nub1 UTSW 5 24692925 missense possibly damaging 0.93
R3825:Nub1 UTSW 5 24707853 missense probably benign 0.21
R4180:Nub1 UTSW 5 24692877 missense probably damaging 0.99
R4593:Nub1 UTSW 5 24709121 missense probably damaging 1.00
R4921:Nub1 UTSW 5 24701469 missense probably benign 0.38
R5282:Nub1 UTSW 5 24695535 missense probably benign 0.04
R5346:Nub1 UTSW 5 24697416 missense probably damaging 0.96
R5533:Nub1 UTSW 5 24702381 missense possibly damaging 0.93
R5567:Nub1 UTSW 5 24708816 missense possibly damaging 0.54
R5802:Nub1 UTSW 5 24702441 missense possibly damaging 0.95
R6966:Nub1 UTSW 5 24689472 missense probably damaging 1.00
R6967:Nub1 UTSW 5 24708711 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTGCTTAGAAGTTGTCCCAGTG -3'
(R):5'- AGACACAAGTGTTCATGCTGC -3'

Sequencing Primer
(F):5'- TCCCAGTGACAGCTGTGGTG -3'
(R):5'- ACACAAGTGTTCATGCTGCATGTG -3'
Posted On2016-07-06