Incidental Mutation 'R0454:Hdac10'
ID39919
Institutional Source Beutler Lab
Gene Symbol Hdac10
Ensembl Gene ENSMUSG00000062906
Gene Namehistone deacetylase 10
Synonyms
MMRRC Submission 038654-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0454 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location89123307-89128700 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 89125758 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041656] [ENSMUST00000082197] [ENSMUST00000088827] [ENSMUST00000109347] [ENSMUST00000109347] [ENSMUST00000109353]
Predicted Effect probably benign
Transcript: ENSMUST00000041656
SMART Domains Protein: ENSMUSP00000040132
Gene: ENSMUSG00000051786

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 355 1667 3.3e-119 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000082197
SMART Domains Protein: ENSMUSP00000080832
Gene: ENSMUSG00000062906

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 13 322 2.1e-85 PFAM
low complexity region 478 489 N/A INTRINSIC
low complexity region 583 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088827
SMART Domains Protein: ENSMUSP00000086207
Gene: ENSMUSG00000022610

DomainStartEndE-ValueType
S_TKc 27 311 1.63e-96 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109347
SMART Domains Protein: ENSMUSP00000104971
Gene: ENSMUSG00000062906

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 13 251 6.1e-66 PFAM
low complexity region 270 282 N/A INTRINSIC
low complexity region 398 409 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109347
SMART Domains Protein: ENSMUSP00000104971
Gene: ENSMUSG00000062906

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 13 251 6.1e-66 PFAM
low complexity region 270 282 N/A INTRINSIC
low complexity region 398 409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109353
SMART Domains Protein: ENSMUSP00000104977
Gene: ENSMUSG00000051786

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 355 1675 2.8e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129398
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143465
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231098
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the histone deacetylase family, members of which deacetylate lysine residues on the N-terminal part of the core histones. Histone deacetylation modulates chromatin structure, and plays an important role in transcriptional regulation, cell cycle progression, and developmental events. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik A G 5: 118,255,821 E88G possibly damaging Het
4930447F04Rik T C X: 66,303,668 E91G unknown Het
Acot1 A G 12: 84,017,339 Q407R probably benign Het
Adcy10 T A 1: 165,570,728 Y1465N probably damaging Het
Ahsa2 T A 11: 23,490,702 I249F probably damaging Het
Arhgap10 T C 8: 77,250,965 N721S probably damaging Het
Arrdc4 T G 7: 68,741,871 E216A probably damaging Het
Axin1 T C 17: 26,173,663 V306A probably benign Het
BC005561 T G 5: 104,518,211 S200A probably benign Het
Cct3 T C 3: 88,302,866 probably null Het
Cfap58 G A 19: 47,974,680 probably null Het
Chd9 T C 8: 90,973,231 S49P possibly damaging Het
Clcn2 C A 16: 20,710,428 probably null Het
Col26a1 T C 5: 136,754,193 N286D probably benign Het
Cpt1b T A 15: 89,424,393 I111F possibly damaging Het
Cyp4f16 T A 17: 32,537,087 I30N probably damaging Het
Ddc T G 11: 11,880,587 D19A possibly damaging Het
Depdc1a T A 3: 159,516,900 probably null Het
Evc2 T A 5: 37,417,484 C1028S possibly damaging Het
Fam228a T C 12: 4,731,457 E134G probably damaging Het
Fasl T C 1: 161,787,954 E111G probably benign Het
Fbxw10 A G 11: 62,876,738 N800S possibly damaging Het
Fras1 T C 5: 96,762,665 S3318P probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gad1 T A 2: 70,579,201 M212K probably damaging Het
Gm17455 T G 10: 60,402,973 S6A probably benign Het
Grm5 T C 7: 88,130,789 S1146P probably damaging Het
Gsn T C 2: 35,304,639 L649P probably damaging Het
H2-DMb1 A G 17: 34,155,711 T112A probably benign Het
Hcn3 T A 3: 89,152,894 I148F probably damaging Het
Hk3 C A 13: 55,008,705 D619Y probably damaging Het
Ifi44 T A 3: 151,745,497 R272S possibly damaging Het
Il1rap A C 16: 26,698,875 D275A probably damaging Het
Itgam A T 7: 128,107,980 N660I probably benign Het
Itpr3 T C 17: 27,113,819 M1853T probably benign Het
Lrmp A G 6: 145,167,984 R293G possibly damaging Het
Lrrc8c A C 5: 105,607,099 K247Q probably damaging Het
Map3k21 T C 8: 125,942,119 S815P probably benign Het
Mast4 A G 13: 102,751,560 S1114P probably damaging Het
Myh8 C T 11: 67,303,765 Q1601* probably null Het
Nhlrc2 A G 19: 56,570,527 D148G probably damaging Het
Nos1 T A 5: 117,943,320 S1196T probably benign Het
Nsmaf C T 4: 6,424,874 probably null Het
Obscn T C 11: 58,999,623 D7361G unknown Het
Olfr1350 C T 7: 6,570,360 A123V probably damaging Het
Olfr600 C A 7: 103,346,878 A17S probably benign Het
Olfr721-ps1 T C 14: 14,407,777 V183A probably damaging Het
Pank3 T G 11: 35,777,709 M175R probably benign Het
Papolg A G 11: 23,879,868 probably null Het
Pcdhb21 G A 18: 37,514,513 D232N probably damaging Het
Pcdhb22 T C 18: 37,518,872 F131S probably damaging Het
Pik3r6 G A 11: 68,528,782 A140T possibly damaging Het
Pinlyp T C 7: 24,542,522 T87A possibly damaging Het
Pld1 T C 3: 28,124,575 S873P probably damaging Het
Pld5 T A 1: 176,274,729 Y49F probably benign Het
Polq T C 16: 37,034,890 V449A probably damaging Het
Prkca A G 11: 107,978,280 V69A probably benign Het
Ptk6 A G 2: 181,202,282 S75P possibly damaging Het
Ptprq G A 10: 107,582,530 Q1662* probably null Het
Ptprt C A 2: 161,553,822 A1144S probably damaging Het
Rrm1 T A 7: 102,466,926 W684R probably damaging Het
Ryr1 T A 7: 29,036,075 M4093L probably damaging Het
Scnn1a C T 6: 125,322,226 L90F probably damaging Het
Slc25a19 G T 11: 115,617,597 Y188* probably null Het
Slc31a1 C T 4: 62,385,629 probably benign Het
Slc5a11 C G 7: 123,265,235 S351R possibly damaging Het
Slc6a17 A G 3: 107,476,867 L387P probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Spam1 T A 6: 24,797,838 L331Q probably damaging Het
Spata32 A G 11: 103,209,299 W127R probably damaging Het
Spta1 T G 1: 174,213,942 I1324S probably damaging Het
St6galnac4 A G 2: 32,594,318 Y176C probably damaging Het
Stk10 A G 11: 32,596,724 E327G probably damaging Het
Stxbp5l T A 16: 37,134,284 Y912F possibly damaging Het
Tchp G A 5: 114,720,182 E459K probably benign Het
Terf2 C T 8: 107,096,210 W100* probably null Het
Thrsp T C 7: 97,417,427 N26S probably damaging Het
Tln1 C A 4: 43,553,504 R297L probably benign Het
Tmeff2 C A 1: 50,928,075 T43N possibly damaging Het
Tmx1 C T 12: 70,453,173 A2V possibly damaging Het
Tnks1bp1 T A 2: 85,072,137 L1053Q probably damaging Het
Trmt10b A T 4: 45,304,286 K107N probably damaging Het
Trpa1 A T 1: 14,885,748 probably null Het
Trrap A G 5: 144,846,477 K3371R probably damaging Het
Tuba3b G A 6: 145,618,269 V14I probably benign Het
Usp19 T C 9: 108,494,240 probably null Het
Usp28 C A 9: 49,039,101 D615E possibly damaging Het
Utp20 T C 10: 88,822,069 D43G probably benign Het
Vmn1r58 T G 7: 5,410,998 K78Q possibly damaging Het
Vmn2r10 T C 5: 109,003,461 M96V probably benign Het
Wdr90 T C 17: 25,860,049 E273G probably damaging Het
Xpc C T 6: 91,491,226 A860T probably benign Het
Zscan21 T C 5: 138,133,603 I463T possibly damaging Het
Other mutations in Hdac10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Hdac10 APN 15 89128442 missense probably damaging 1.00
IGL01063:Hdac10 APN 15 89123868 missense possibly damaging 0.68
IGL01577:Hdac10 APN 15 89126213 missense possibly damaging 0.90
IGL01690:Hdac10 APN 15 89125991 missense probably benign 0.00
IGL01724:Hdac10 APN 15 89124709 unclassified probably benign
IGL01866:Hdac10 APN 15 89124533 missense probably damaging 1.00
IGL01989:Hdac10 APN 15 89125343 missense probably damaging 1.00
IGL01995:Hdac10 APN 15 89127598 missense probably damaging 1.00
IGL02256:Hdac10 APN 15 89125894 unclassified probably benign
IGL02668:Hdac10 APN 15 89125644 missense probably benign 0.10
R0240:Hdac10 UTSW 15 89125882 missense possibly damaging 0.65
R0240:Hdac10 UTSW 15 89125882 missense possibly damaging 0.65
R0723:Hdac10 UTSW 15 89126418 missense probably damaging 1.00
R0924:Hdac10 UTSW 15 89125862 missense probably benign
R1553:Hdac10 UTSW 15 89125515 missense possibly damaging 0.51
R1608:Hdac10 UTSW 15 89125318 missense probably benign 0.04
R1619:Hdac10 UTSW 15 89126675 missense probably damaging 1.00
R1715:Hdac10 UTSW 15 89126709 splice site probably null
R2284:Hdac10 UTSW 15 89127404 missense probably benign 0.00
R2872:Hdac10 UTSW 15 89125856 missense possibly damaging 0.46
R2872:Hdac10 UTSW 15 89125856 missense possibly damaging 0.46
R3688:Hdac10 UTSW 15 89123564 critical splice donor site probably null
R4283:Hdac10 UTSW 15 89125623 missense possibly damaging 0.94
R4604:Hdac10 UTSW 15 89125397 critical splice acceptor site probably null
R4654:Hdac10 UTSW 15 89126833 unclassified probably benign
R4898:Hdac10 UTSW 15 89128447 start codon destroyed probably null 1.00
R4998:Hdac10 UTSW 15 89123940 missense possibly damaging 0.94
R5393:Hdac10 UTSW 15 89126684 missense probably damaging 1.00
R5769:Hdac10 UTSW 15 89123616 missense probably benign 0.00
R5785:Hdac10 UTSW 15 89126945 missense probably benign
R6992:Hdac10 UTSW 15 89125331 missense probably benign 0.01
R7149:Hdac10 UTSW 15 89127449 missense probably damaging 1.00
R7237:Hdac10 UTSW 15 89125377 missense probably benign
R7276:Hdac10 UTSW 15 89128285 missense probably benign 0.01
R7395:Hdac10 UTSW 15 89128284 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GACTGACCCTTCTTGATGGAGCAC -3'
(R):5'- TGCCATGTCAGAGGTTTGAAGACTG -3'

Sequencing Primer
(F):5'- TTCTTGATGGAGCACTCCAG -3'
(R):5'- TTTGAAGACTGGAGAGCCAGTG -3'
Posted On2013-05-23