Incidental Mutation 'R0454:Il1rap'
ID39923
Institutional Source Beutler Lab
Gene Symbol Il1rap
Ensembl Gene ENSMUSG00000022514
Gene Nameinterleukin 1 receptor accessory protein
SynonymsIL-1RAcP, 6430709H04Rik, IL-1R AcP
MMRRC Submission 038654-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0454 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location26581704-26730117 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 26698875 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 275 (D275A)
Ref Sequence ENSEMBL: ENSMUSP00000133904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023156] [ENSMUST00000096129] [ENSMUST00000166294] [ENSMUST00000174171] [ENSMUST00000174202]
Predicted Effect probably damaging
Transcript: ENSMUST00000023156
AA Change: D275A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023156
Gene: ENSMUSG00000022514
AA Change: D275A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 32 132 1.21e-2 SMART
IG 145 232 4.04e0 SMART
IG 251 350 1.46e-5 SMART
low complexity region 368 381 N/A INTRINSIC
TIR 404 549 5.29e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000096129
AA Change: D275A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093843
Gene: ENSMUSG00000022514
AA Change: D275A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 32 132 1.21e-2 SMART
IG 145 232 4.04e0 SMART
IG 251 350 1.46e-5 SMART
low complexity region 368 381 N/A INTRINSIC
TIR 404 547 1.38e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166294
AA Change: D275A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128100
Gene: ENSMUSG00000022514
AA Change: D275A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 32 132 1.21e-2 SMART
IG 145 232 4.04e0 SMART
IG 251 350 1.46e-5 SMART
low complexity region 368 381 N/A INTRINSIC
TIR 404 547 1.38e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174171
AA Change: D275A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133904
Gene: ENSMUSG00000022514
AA Change: D275A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 32 132 1.21e-2 SMART
IG 145 232 4.04e0 SMART
Blast:IG 251 312 1e-28 BLAST
low complexity region 316 332 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174202
AA Change: D275A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134202
Gene: ENSMUSG00000022514
AA Change: D275A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 32 132 1.21e-2 SMART
IG 145 232 4.04e0 SMART
IG 251 350 1.46e-5 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interleukin 1 induces synthesis of acute phase and proinflammatory proteins during infection, tissue damage, or stress, by forming a complex at the cell membrane with an interleukin 1 receptor and an accessory protein. This gene encodes the interleukin 1 receptor accessory protein. The protein is a necessary part of the interleukin 1 receptor complex which initiates signalling events that result in the activation of interleukin 1-responsive genes. Alternative splicing of this gene results in two transcript variants encoding two different isoforms, one membrane-bound and one soluble. The ratio of soluble to membrane-bound forms increases during acute-phase induction or stress. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal but show no biological response to IL-1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik A G 5: 118,255,821 E88G possibly damaging Het
4930447F04Rik T C X: 66,303,668 E91G unknown Het
Acot1 A G 12: 84,017,339 Q407R probably benign Het
Adcy10 T A 1: 165,570,728 Y1465N probably damaging Het
Ahsa2 T A 11: 23,490,702 I249F probably damaging Het
Arhgap10 T C 8: 77,250,965 N721S probably damaging Het
Arrdc4 T G 7: 68,741,871 E216A probably damaging Het
Axin1 T C 17: 26,173,663 V306A probably benign Het
BC005561 T G 5: 104,518,211 S200A probably benign Het
Cct3 T C 3: 88,302,866 probably null Het
Cfap58 G A 19: 47,974,680 probably null Het
Chd9 T C 8: 90,973,231 S49P possibly damaging Het
Clcn2 C A 16: 20,710,428 probably null Het
Col26a1 T C 5: 136,754,193 N286D probably benign Het
Cpt1b T A 15: 89,424,393 I111F possibly damaging Het
Cyp4f16 T A 17: 32,537,087 I30N probably damaging Het
Ddc T G 11: 11,880,587 D19A possibly damaging Het
Depdc1a T A 3: 159,516,900 probably null Het
Evc2 T A 5: 37,417,484 C1028S possibly damaging Het
Fam228a T C 12: 4,731,457 E134G probably damaging Het
Fasl T C 1: 161,787,954 E111G probably benign Het
Fbxw10 A G 11: 62,876,738 N800S possibly damaging Het
Fras1 T C 5: 96,762,665 S3318P probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gad1 T A 2: 70,579,201 M212K probably damaging Het
Gm17455 T G 10: 60,402,973 S6A probably benign Het
Grm5 T C 7: 88,130,789 S1146P probably damaging Het
Gsn T C 2: 35,304,639 L649P probably damaging Het
H2-DMb1 A G 17: 34,155,711 T112A probably benign Het
Hcn3 T A 3: 89,152,894 I148F probably damaging Het
Hdac10 T C 15: 89,125,758 probably null Het
Hk3 C A 13: 55,008,705 D619Y probably damaging Het
Ifi44 T A 3: 151,745,497 R272S possibly damaging Het
Itgam A T 7: 128,107,980 N660I probably benign Het
Itpr3 T C 17: 27,113,819 M1853T probably benign Het
Lrmp A G 6: 145,167,984 R293G possibly damaging Het
Lrrc8c A C 5: 105,607,099 K247Q probably damaging Het
Map3k21 T C 8: 125,942,119 S815P probably benign Het
Mast4 A G 13: 102,751,560 S1114P probably damaging Het
Myh8 C T 11: 67,303,765 Q1601* probably null Het
Nhlrc2 A G 19: 56,570,527 D148G probably damaging Het
Nos1 T A 5: 117,943,320 S1196T probably benign Het
Nsmaf C T 4: 6,424,874 probably null Het
Obscn T C 11: 58,999,623 D7361G unknown Het
Olfr1350 C T 7: 6,570,360 A123V probably damaging Het
Olfr600 C A 7: 103,346,878 A17S probably benign Het
Olfr721-ps1 T C 14: 14,407,777 V183A probably damaging Het
Pank3 T G 11: 35,777,709 M175R probably benign Het
Papolg A G 11: 23,879,868 probably null Het
Pcdhb21 G A 18: 37,514,513 D232N probably damaging Het
Pcdhb22 T C 18: 37,518,872 F131S probably damaging Het
Pik3r6 G A 11: 68,528,782 A140T possibly damaging Het
Pinlyp T C 7: 24,542,522 T87A possibly damaging Het
Pld1 T C 3: 28,124,575 S873P probably damaging Het
Pld5 T A 1: 176,274,729 Y49F probably benign Het
Polq T C 16: 37,034,890 V449A probably damaging Het
Prkca A G 11: 107,978,280 V69A probably benign Het
Ptk6 A G 2: 181,202,282 S75P possibly damaging Het
Ptprq G A 10: 107,582,530 Q1662* probably null Het
Ptprt C A 2: 161,553,822 A1144S probably damaging Het
Rrm1 T A 7: 102,466,926 W684R probably damaging Het
Ryr1 T A 7: 29,036,075 M4093L probably damaging Het
Scnn1a C T 6: 125,322,226 L90F probably damaging Het
Slc25a19 G T 11: 115,617,597 Y188* probably null Het
Slc31a1 C T 4: 62,385,629 probably benign Het
Slc5a11 C G 7: 123,265,235 S351R possibly damaging Het
Slc6a17 A G 3: 107,476,867 L387P probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Spam1 T A 6: 24,797,838 L331Q probably damaging Het
Spata32 A G 11: 103,209,299 W127R probably damaging Het
Spta1 T G 1: 174,213,942 I1324S probably damaging Het
St6galnac4 A G 2: 32,594,318 Y176C probably damaging Het
Stk10 A G 11: 32,596,724 E327G probably damaging Het
Stxbp5l T A 16: 37,134,284 Y912F possibly damaging Het
Tchp G A 5: 114,720,182 E459K probably benign Het
Terf2 C T 8: 107,096,210 W100* probably null Het
Thrsp T C 7: 97,417,427 N26S probably damaging Het
Tln1 C A 4: 43,553,504 R297L probably benign Het
Tmeff2 C A 1: 50,928,075 T43N possibly damaging Het
Tmx1 C T 12: 70,453,173 A2V possibly damaging Het
Tnks1bp1 T A 2: 85,072,137 L1053Q probably damaging Het
Trmt10b A T 4: 45,304,286 K107N probably damaging Het
Trpa1 A T 1: 14,885,748 probably null Het
Trrap A G 5: 144,846,477 K3371R probably damaging Het
Tuba3b G A 6: 145,618,269 V14I probably benign Het
Usp19 T C 9: 108,494,240 probably null Het
Usp28 C A 9: 49,039,101 D615E possibly damaging Het
Utp20 T C 10: 88,822,069 D43G probably benign Het
Vmn1r58 T G 7: 5,410,998 K78Q possibly damaging Het
Vmn2r10 T C 5: 109,003,461 M96V probably benign Het
Wdr90 T C 17: 25,860,049 E273G probably damaging Het
Xpc C T 6: 91,491,226 A860T probably benign Het
Zscan21 T C 5: 138,133,603 I463T possibly damaging Het
Other mutations in Il1rap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Il1rap APN 16 26722401 missense possibly damaging 0.77
IGL00976:Il1rap APN 16 26698839 missense probably benign 0.09
IGL01075:Il1rap APN 16 26680237 missense possibly damaging 0.94
IGL01665:Il1rap APN 16 26722713 missense probably damaging 1.00
IGL01962:Il1rap APN 16 26710568 nonsense probably null
IGL02101:Il1rap APN 16 26624182 missense possibly damaging 0.61
IGL02411:Il1rap APN 16 26710616 missense probably damaging 1.00
IGL03132:Il1rap APN 16 26680119 missense probably damaging 1.00
bacchus UTSW 16 26710632 critical splice donor site probably null
I1329:Il1rap UTSW 16 26692850 missense probably benign 0.07
LCD18:Il1rap UTSW 16 26631593 intron probably benign
PIT1430001:Il1rap UTSW 16 26710593 missense possibly damaging 0.53
R0302:Il1rap UTSW 16 26692794 missense probably benign 0.02
R0481:Il1rap UTSW 16 26692835 missense probably damaging 1.00
R0612:Il1rap UTSW 16 26701105 missense possibly damaging 0.48
R0765:Il1rap UTSW 16 26710632 critical splice donor site probably null
R1552:Il1rap UTSW 16 26722434 missense possibly damaging 0.79
R1801:Il1rap UTSW 16 26698875 missense probably damaging 1.00
R1867:Il1rap UTSW 16 26722926 missense probably damaging 1.00
R1942:Il1rap UTSW 16 26722455 missense probably damaging 1.00
R1996:Il1rap UTSW 16 26722493 missense probably benign 0.06
R2118:Il1rap UTSW 16 26710565 missense probably damaging 1.00
R2122:Il1rap UTSW 16 26710565 missense probably damaging 1.00
R2124:Il1rap UTSW 16 26710565 missense probably damaging 1.00
R3104:Il1rap UTSW 16 26722752 missense probably benign 0.01
R3105:Il1rap UTSW 16 26722752 missense probably benign 0.01
R3106:Il1rap UTSW 16 26722752 missense probably benign 0.01
R3891:Il1rap UTSW 16 26676856 missense probably damaging 1.00
R4133:Il1rap UTSW 16 26722886 missense probably benign 0.34
R4409:Il1rap UTSW 16 26712265 splice site probably null
R4610:Il1rap UTSW 16 26714776 missense probably benign 0.11
R4755:Il1rap UTSW 16 26722782 missense probably benign 0.20
R4776:Il1rap UTSW 16 26692799 missense possibly damaging 0.57
R4793:Il1rap UTSW 16 26695234 missense probably benign 0.09
R4811:Il1rap UTSW 16 26701238 critical splice donor site probably null
R4834:Il1rap UTSW 16 26676935 missense probably damaging 1.00
R5119:Il1rap UTSW 16 26624199 missense probably benign 0.01
R5744:Il1rap UTSW 16 26680224 missense probably benign 0.01
R6108:Il1rap UTSW 16 26722707 missense probably damaging 1.00
R6149:Il1rap UTSW 16 26712219 missense probably damaging 1.00
R6233:Il1rap UTSW 16 26710506 missense probably benign 0.24
R6246:Il1rap UTSW 16 26714881 missense probably benign
R6249:Il1rap UTSW 16 26692848 missense possibly damaging 0.88
R6254:Il1rap UTSW 16 26695270 missense probably benign
R6748:Il1rap UTSW 16 26722356 missense probably benign 0.02
R7151:Il1rap UTSW 16 26712128 missense probably damaging 1.00
X0027:Il1rap UTSW 16 26701147 missense probably benign 0.20
X0028:Il1rap UTSW 16 26676964 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACAAGGACCCACCATTTACAGAC -3'
(R):5'- GCACTTGCCTTGCTAGTTTAATGACCC -3'

Sequencing Primer
(F):5'- agaaagaaagaaagagagagagagag -3'
(R):5'- GCCCCTGAAGGTTGAAAAATCTTG -3'
Posted On2013-05-23