Incidental Mutation 'R5253:Rbm6'
ID399235
Institutional Source Beutler Lab
Gene Symbol Rbm6
Ensembl Gene ENSMUSG00000032582
Gene NameRNA binding motif protein 6
Synonymsg16, NY-LU-12, Def-3
MMRRC Submission 042824-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.917) question?
Stock #R5253 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location107773559-107873237 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 107852657 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 132 (R132K)
Ref Sequence ENSEMBL: ENSMUSP00000035201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035201] [ENSMUST00000181986] [ENSMUST00000183032] [ENSMUST00000183035] [ENSMUST00000195866] [ENSMUST00000195883]
Predicted Effect probably damaging
Transcript: ENSMUST00000035201
AA Change: R132K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000035201
Gene: ENSMUSG00000032582
AA Change: R132K

DomainStartEndE-ValueType
internal_repeat_1 4 42 2.66e-5 PROSPERO
low complexity region 61 87 N/A INTRINSIC
internal_repeat_1 106 157 2.66e-5 PROSPERO
RRM 325 400 2.67e-2 SMART
Blast:ZnF_RBZ 406 430 2e-11 BLAST
RRM 522 601 1.32e-1 SMART
low complexity region 748 765 N/A INTRINSIC
ZnF_C2H2 818 843 4.34e0 SMART
low complexity region 864 876 N/A INTRINSIC
G_patch 912 958 7.87e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182301
Predicted Effect probably damaging
Transcript: ENSMUST00000183032
AA Change: R264K

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138400
Gene: ENSMUSG00000032582
AA Change: R264K

DomainStartEndE-ValueType
internal_repeat_1 43 119 2.42e-5 PROSPERO
internal_repeat_2 46 164 3.18e-5 PROSPERO
internal_repeat_1 121 189 2.42e-5 PROSPERO
low complexity region 193 219 N/A INTRINSIC
internal_repeat_2 224 319 3.18e-5 PROSPERO
RRM 457 532 2.67e-2 SMART
Blast:ZnF_RBZ 538 562 2e-9 BLAST
RRM 654 733 1.32e-1 SMART
low complexity region 880 897 N/A INTRINSIC
ZnF_C2H2 950 975 4.34e0 SMART
low complexity region 996 1008 N/A INTRINSIC
G_patch 1044 1090 7.87e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183035
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193957
Predicted Effect probably benign
Transcript: ENSMUST00000195866
Predicted Effect probably benign
Transcript: ENSMUST00000195883
SMART Domains Protein: ENSMUSP00000141953
Gene: ENSMUSG00000032582

DomainStartEndE-ValueType
Blast:ZnF_RBZ 24 48 9e-12 BLAST
Meta Mutation Damage Score 0.19 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik T C 9: 40,051,450 noncoding transcript Het
Actrt2 A C 4: 154,667,569 S37A possibly damaging Het
Adcy7 T C 8: 88,314,114 I327T probably damaging Het
Ankrd13b A G 11: 77,473,235 probably benign Het
Arap1 A C 7: 101,388,644 I237L probably benign Het
Arhgap17 A T 7: 123,303,748 Y359N probably benign Het
Atad1 A G 19: 32,674,302 M343T probably benign Het
Cacna1b A T 2: 24,719,952 I392N probably damaging Het
Cacna1c A G 6: 118,597,969 S1914P probably benign Het
Cd300a G T 11: 114,894,751 R174L probably benign Het
Dip2a G A 10: 76,299,997 P356L probably damaging Het
Dsg1c T C 18: 20,272,379 L283P probably damaging Het
Dusp1 T C 17: 26,508,217 N36S probably benign Het
Ercc3 C A 18: 32,269,864 P776Q probably damaging Het
Etv1 A G 12: 38,852,249 R260G possibly damaging Het
Fa2h C G 8: 111,349,237 M251I probably benign Het
Flg2 A G 3: 93,200,812 D49G probably damaging Het
Fras1 A G 5: 96,741,025 E2810G probably damaging Het
Fuk T C 8: 110,883,867 E968G possibly damaging Het
Gabbr1 T C 17: 37,055,913 F343S possibly damaging Het
Gdf2 A G 14: 33,945,307 T329A probably benign Het
Hcn4 T A 9: 58,824,275 I255N unknown Het
Hk3 T G 13: 55,011,011 D485A probably damaging Het
Hook3 T C 8: 26,072,291 T249A probably benign Het
Kcp C T 6: 29,498,520 probably benign Het
Kifc2 G T 15: 76,666,281 R515L possibly damaging Het
Kiss1r A G 10: 79,920,750 Y142C probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klrb1a T A 6: 128,619,163 I72L probably benign Het
Lep T A 6: 29,070,863 F62Y probably damaging Het
Lrtm1 A G 14: 29,021,844 T90A probably benign Het
Mug1 A T 6: 121,888,913 D1472V probably benign Het
Ncor2 G T 5: 125,026,930 P1988Q probably benign Het
Nlrp4a C T 7: 26,450,492 S508L probably benign Het
Obp2b T A 2: 25,737,143 D29E probably benign Het
Olfr1123 G A 2: 87,418,668 V207M possibly damaging Het
Olfr1214 A G 2: 88,988,100 L34P possibly damaging Het
Olfr1224-ps1 A T 2: 89,156,457 C239* probably null Het
Olfr725 T C 14: 50,035,288 I38M possibly damaging Het
Olfr803 A G 10: 129,691,732 I103T probably damaging Het
Otof A G 5: 30,370,139 S1985P probably damaging Het
Oxct2a A T 4: 123,323,093 V165E probably damaging Het
Papd5 C A 8: 88,200,023 H20Q possibly damaging Het
Pcdhgb7 T C 18: 37,753,097 V440A possibly damaging Het
Pelp1 C A 11: 70,401,661 G211C probably damaging Het
Phox2a A G 7: 101,822,105 H268R probably benign Het
Pik3c2g T C 6: 139,896,257 probably null Het
Pramel1 T A 4: 143,398,586 M360K probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc45a1 T C 4: 150,638,270 T386A probably damaging Het
Smad2 A G 18: 76,288,053 Y151C probably damaging Het
Sptbn2 G A 19: 4,750,082 G2188D probably benign Het
Sugt1 G A 14: 79,602,901 probably null Het
Tctn3 T C 19: 40,607,241 S367G probably benign Het
Tead1 G T 7: 112,861,545 D219Y probably damaging Het
Tenm2 G T 11: 36,047,201 Y1548* probably null Het
Tenm3 T A 8: 48,229,198 I2466F possibly damaging Het
Tgm2 G A 2: 158,129,438 P294S probably damaging Het
Tns2 T C 15: 102,111,453 S585P probably damaging Het
Ttc41 A G 10: 86,730,942 K491E probably benign Het
Ttn G A 2: 76,791,551 T15549I probably damaging Het
Vmn1r157 T C 7: 22,761,758 L21P probably damaging Het
Vmn2r81 A G 10: 79,247,986 M65V probably benign Het
Wdr34 T A 2: 30,032,363 probably benign Het
Zcchc14 T C 8: 121,618,694 probably benign Het
Other mutations in Rbm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Rbm6 APN 9 107788349 missense probably damaging 1.00
IGL01647:Rbm6 APN 9 107852882 missense probably benign 0.13
IGL01872:Rbm6 APN 9 107783715 missense probably damaging 0.99
IGL02402:Rbm6 APN 9 107852852 missense probably damaging 1.00
IGL03024:Rbm6 APN 9 107787368 missense probably damaging 0.97
IGL03025:Rbm6 APN 9 107774719 missense possibly damaging 0.76
FR4737:Rbm6 UTSW 9 107782755 frame shift probably null
PIT4402001:Rbm6 UTSW 9 107787850 missense probably damaging 1.00
R0511:Rbm6 UTSW 9 107847289 nonsense probably null
R1666:Rbm6 UTSW 9 107791856 missense probably benign 0.15
R1927:Rbm6 UTSW 9 107852903 missense probably damaging 1.00
R2173:Rbm6 UTSW 9 107852191 missense possibly damaging 0.79
R2262:Rbm6 UTSW 9 107791090 missense probably damaging 1.00
R2439:Rbm6 UTSW 9 107779597 missense probably damaging 1.00
R2566:Rbm6 UTSW 9 107791998 missense possibly damaging 0.60
R2878:Rbm6 UTSW 9 107852450 missense probably damaging 1.00
R4342:Rbm6 UTSW 9 107847247 intron probably benign
R4783:Rbm6 UTSW 9 107852903 missense probably damaging 1.00
R4785:Rbm6 UTSW 9 107787352 missense probably benign 0.06
R5205:Rbm6 UTSW 9 107788343 missense probably benign 0.08
R5279:Rbm6 UTSW 9 107778014 missense probably benign 0.00
R5356:Rbm6 UTSW 9 107852666 missense probably damaging 1.00
R6289:Rbm6 UTSW 9 107777948 missense probably damaging 1.00
R6328:Rbm6 UTSW 9 107787259 missense probably benign 0.00
R6564:Rbm6 UTSW 9 107833498 missense probably damaging 1.00
R6887:Rbm6 UTSW 9 107852231 missense probably damaging 1.00
R6978:Rbm6 UTSW 9 107852575 intron probably null
R7139:Rbm6 UTSW 9 107853211 missense probably damaging 1.00
R7240:Rbm6 UTSW 9 107852896 missense probably damaging 1.00
R7330:Rbm6 UTSW 9 107791045 missense possibly damaging 0.77
R7397:Rbm6 UTSW 9 107852519 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAGGTCTTTCCATTGCATG -3'
(R):5'- ATCCCATTCAGATTTTAGGGGAAG -3'

Sequencing Primer
(F):5'- CCATTGCATGGTCATGTATGGATTC -3'
(R):5'- TAGGGGAAGAGATTTATCAGATTTGG -3'
Posted On2016-07-06