Incidental Mutation 'R5176:Ttll4'
ID399238
Institutional Source Beutler Lab
Gene Symbol Ttll4
Ensembl Gene ENSMUSG00000033257
Gene Nametubulin tyrosine ligase-like family, member 4
Synonyms4632407P03Rik
MMRRC Submission 042756-MU
Accession Numbers

Genbank: NM_001014974.1; Ensembl: ENSMUST00000042125

Is this an essential gene? Possibly non essential (E-score: 0.323) question?
Stock #R5176 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location74661745-74703730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 74679286 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 99 (H99N)
Ref Sequence ENSEMBL: ENSMUSP00000037406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042125] [ENSMUST00000113678] [ENSMUST00000129890] [ENSMUST00000141119]
Predicted Effect probably damaging
Transcript: ENSMUST00000042125
AA Change: H99N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037406
Gene: ENSMUSG00000033257
AA Change: H99N

DomainStartEndE-ValueType
low complexity region 504 544 N/A INTRINSIC
Pfam:TTL 645 940 2.2e-106 PFAM
low complexity region 942 961 N/A INTRINSIC
low complexity region 1103 1113 N/A INTRINSIC
low complexity region 1168 1182 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113678
AA Change: H99N

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109308
Gene: ENSMUSG00000033257
AA Change: H99N

DomainStartEndE-ValueType
low complexity region 504 544 N/A INTRINSIC
Pfam:TTL 636 876 3.4e-82 PFAM
low complexity region 878 897 N/A INTRINSIC
low complexity region 1039 1049 N/A INTRINSIC
low complexity region 1104 1118 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129890
SMART Domains Protein: ENSMUSP00000119964
Gene: ENSMUSG00000033257

DomainStartEndE-ValueType
low complexity region 69 101 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141119
SMART Domains Protein: ENSMUSP00000116733
Gene: ENSMUSG00000033257

DomainStartEndE-ValueType
low complexity region 56 96 N/A INTRINSIC
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (69/70)
Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik C T 1: 85,088,800 probably benign Het
Abca7 C A 10: 79,998,289 H116Q probably benign Het
Akap12 G T 10: 4,353,947 E252D probably benign Het
Apobr A G 7: 126,585,016 D2G probably damaging Het
Arhgef12 A T 9: 43,020,686 H168Q probably damaging Het
Asb3 T A 11: 31,081,357 probably null Het
Brip1 T C 11: 86,077,884 Y825C probably damaging Het
Cacna1b A T 2: 24,635,131 Y1679N probably damaging Het
Ccdc69 C T 11: 55,060,470 A42T probably benign Het
Cds1 G T 5: 101,781,420 D55Y possibly damaging Het
Cep135 C A 5: 76,637,026 D989E probably benign Het
Cpsf6 C A 10: 117,361,284 probably benign Het
Ctif C T 18: 75,637,219 V32M probably damaging Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dao T C 5: 114,020,009 probably null Het
Dopey1 T A 9: 86,521,815 N1689K probably damaging Het
Dopey2 A G 16: 93,740,043 Y14C probably damaging Het
E130309D02Rik G T 5: 143,315,075 S7* probably null Het
Fam160b1 A G 19: 57,371,181 N51S probably damaging Het
Fam187a C T 11: 102,886,464 R365C probably damaging Het
Fastkd2 A G 1: 63,731,439 probably benign Het
Fkbp15 G T 4: 62,312,323 L718I possibly damaging Het
Gabbr2 C A 4: 46,681,208 V118F probably damaging Het
Gm11492 T A 11: 87,567,532 M244K probably benign Het
Gm13991 T A 2: 116,528,027 noncoding transcript Het
H2-M9 T C 17: 36,641,631 I174M probably damaging Het
Insr T A 8: 3,158,742 M1240L probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Mad2l1bp T A 17: 46,152,812 E95D probably benign Het
March9 T C 10: 127,059,450 D102G probably benign Het
Muc19 A G 15: 91,892,180 noncoding transcript Het
Nr1h4 T A 10: 89,498,255 Y91F probably benign Het
Nr5a2 A T 1: 136,948,802 M1K probably null Het
Olfr561 T A 7: 102,775,306 S261T probably damaging Het
Olfr836 A T 9: 19,121,360 Y132F probably damaging Het
Olfr998 A C 2: 85,591,435 K298N possibly damaging Het
Oprd1 T C 4: 132,113,793 T285A probably benign Het
Optc T C 1: 133,902,084 N196S probably benign Het
Panx2 G T 15: 89,060,228 R52L probably damaging Het
Pdzd8 A G 19: 59,344,957 F211L probably damaging Het
Pot1b T A 17: 55,699,995 T41S probably benign Het
Prss56 T C 1: 87,184,158 L37S probably damaging Het
Ptk2b T C 14: 66,156,415 T870A probably damaging Het
Rabep2 C A 7: 126,434,293 probably benign Het
Rbm48 A C 5: 3,595,444 V80G probably damaging Het
Rhou G T 8: 123,654,109 C55F possibly damaging Het
Rnaseh2c A G 19: 5,602,042 D45G probably benign Het
Rusc1 A G 3: 89,089,082 S109P probably damaging Het
Ryr3 T C 2: 112,757,667 D2643G possibly damaging Het
Sik2 T C 9: 50,899,403 E471G probably benign Het
Sipa1 A G 19: 5,659,378 S310P probably damaging Het
Spen T C 4: 141,476,276 E1680G unknown Het
Steap3 C T 1: 120,243,767 probably null Het
Tmeff2 T A 1: 51,071,541 C171* probably null Het
Tmem138 A T 19: 10,575,270 M33K probably benign Het
Trappc11 C A 8: 47,510,963 V601L possibly damaging Het
Ttc30a2 T C 2: 75,977,077 M364V probably benign Het
Uchl4 A T 9: 64,235,740 K168* probably null Het
Wdr17 C T 8: 54,653,878 probably null Het
Xpo1 A G 11: 23,295,977 D1029G probably damaging Het
Zfp719 G T 7: 43,591,125 K712N probably damaging Het
Other mutations in Ttll4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01606:Ttll4 APN 1 74685893 missense probably damaging 1.00
IGL01743:Ttll4 APN 1 74688193 missense possibly damaging 0.63
IGL01914:Ttll4 APN 1 74679058 missense probably benign 0.01
IGL02288:Ttll4 APN 1 74679401 missense probably benign 0.05
IGL02621:Ttll4 APN 1 74687484 missense probably damaging 1.00
IGL02662:Ttll4 APN 1 74687231 unclassified probably null
IGL02890:Ttll4 APN 1 74687339 nonsense probably null
IGL02937:Ttll4 APN 1 74679503 missense possibly damaging 0.92
IGL03178:Ttll4 APN 1 74680408 missense probably damaging 0.96
IGL03412:Ttll4 APN 1 74687321 missense probably benign 0.28
1mM(1):Ttll4 UTSW 1 74689980 missense probably null 1.00
R0083:Ttll4 UTSW 1 74679769 missense probably benign 0.13
R0108:Ttll4 UTSW 1 74679769 missense probably benign 0.13
R0135:Ttll4 UTSW 1 74679928 missense possibly damaging 0.86
R0137:Ttll4 UTSW 1 74679692 missense possibly damaging 0.74
R0306:Ttll4 UTSW 1 74696757 missense probably benign 0.28
R0506:Ttll4 UTSW 1 74688618 missense probably benign 0.06
R0555:Ttll4 UTSW 1 74688280 missense probably damaging 1.00
R1617:Ttll4 UTSW 1 74679401 missense probably benign 0.05
R1649:Ttll4 UTSW 1 74697470 missense possibly damaging 0.52
R1793:Ttll4 UTSW 1 74687840 missense possibly damaging 0.91
R1898:Ttll4 UTSW 1 74697482 missense probably benign 0.01
R1952:Ttll4 UTSW 1 74687559 missense probably damaging 0.99
R1987:Ttll4 UTSW 1 74685368 missense possibly damaging 0.81
R1989:Ttll4 UTSW 1 74685368 missense possibly damaging 0.81
R2067:Ttll4 UTSW 1 74680382 missense possibly damaging 0.94
R2162:Ttll4 UTSW 1 74686391 missense probably damaging 1.00
R2185:Ttll4 UTSW 1 74679829 missense possibly damaging 0.54
R2875:Ttll4 UTSW 1 74686438 unclassified probably null
R2876:Ttll4 UTSW 1 74686438 unclassified probably null
R2895:Ttll4 UTSW 1 74685358 missense possibly damaging 0.92
R2896:Ttll4 UTSW 1 74685358 missense possibly damaging 0.92
R3157:Ttll4 UTSW 1 74697611 missense possibly damaging 0.81
R3832:Ttll4 UTSW 1 74686391 missense probably damaging 1.00
R4707:Ttll4 UTSW 1 74679007 missense possibly damaging 0.62
R4784:Ttll4 UTSW 1 74679007 missense possibly damaging 0.62
R4785:Ttll4 UTSW 1 74679007 missense possibly damaging 0.62
R5202:Ttll4 UTSW 1 74687852 critical splice donor site probably null
R5244:Ttll4 UTSW 1 74696448 missense probably benign 0.30
R5264:Ttll4 UTSW 1 74686376 missense possibly damaging 0.92
R5452:Ttll4 UTSW 1 74679321 missense probably benign 0.06
R5992:Ttll4 UTSW 1 74685391 missense probably damaging 1.00
R6111:Ttll4 UTSW 1 74697539 missense possibly damaging 0.95
R6722:Ttll4 UTSW 1 74681789 missense possibly damaging 0.95
R6776:Ttll4 UTSW 1 74681353 missense probably damaging 1.00
R6815:Ttll4 UTSW 1 74679349 missense possibly damaging 0.89
R6836:Ttll4 UTSW 1 74689413 missense probably damaging 0.98
R6963:Ttll4 UTSW 1 74681816 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCTTCACCATCTGAGAAACC -3'
(R):5'- TGGCTTTATTGGCAGTGACAC -3'

Sequencing Primer
(F):5'- AACCCTCGGAGGTCAAAGTCTG -3'
(R):5'- CTGACAGGAAGACCCTTCTGAG -3'
Posted On2016-07-06