Incidental Mutation 'R5253:Etv1'
ID399254
Institutional Source Beutler Lab
Gene Symbol Etv1
Ensembl Gene ENSMUSG00000004151
Gene Nameets variant 1
SynonymsEtsrp81, ER81
MMRRC Submission 042824-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.539) question?
Stock #R5253 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location38779380-38870484 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38852249 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 260 (R260G)
Ref Sequence ENSEMBL: ENSMUSP00000125692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095767] [ENSMUST00000159334] [ENSMUST00000160244] [ENSMUST00000160701] [ENSMUST00000160856] [ENSMUST00000161980] [ENSMUST00000162563]
Predicted Effect probably benign
Transcript: ENSMUST00000095767
AA Change: R278G

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000093442
Gene: ENSMUSG00000004151
AA Change: R278G

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 1 333 5e-153 PFAM
ETS 334 419 1.72e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159334
AA Change: R238G

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000125676
Gene: ENSMUSG00000004151
AA Change: R238G

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 16 293 1.1e-112 PFAM
ETS 294 379 1.72e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160244
SMART Domains Protein: ENSMUSP00000125733
Gene: ENSMUSG00000004151

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 1 310 2.5e-133 PFAM
ETS 311 396 1.72e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160701
AA Change: R175G

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000124019
Gene: ENSMUSG00000004151
AA Change: R175G

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 14 82 1.4e-30 PFAM
Pfam:ETS_PEA3_N 80 230 1.6e-68 PFAM
ETS 231 316 1.72e-57 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000160856
AA Change: R260G

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125692
Gene: ENSMUSG00000004151
AA Change: R260G

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 1 315 3.8e-130 PFAM
ETS 316 401 1.72e-57 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161591
Predicted Effect probably benign
Transcript: ENSMUST00000161980
AA Change: R220G

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000124736
Gene: ENSMUSG00000004151
AA Change: R220G

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 10 275 3.2e-104 PFAM
ETS 276 361 1.72e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162563
AA Change: R278G

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000125157
Gene: ENSMUSG00000004151
AA Change: R278G

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 1 333 5.6e-150 PFAM
ETS 334 419 1.72e-57 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162730
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ETS (E twenty-six) family of transcription factors. The ETS proteins regulate many target genes that modulate biological processes like cell growth, angiogenesis, migration, proliferation and differentiation. All ETS proteins contain an ETS DNA-binding domain that binds to DNA sequences containing the consensus 5'-CGGA[AT]-3'. The protein encoded by this gene contains a conserved short acidic transactivation domain (TAD) in the N-terminal region, in addition to the ETS DNA-binding domain in the C-terminal region. This gene is involved in chromosomal translocations, which result in multiple fusion proteins including EWS-ETV1 in Ewing sarcoma and at least 10 ETV1 partners (see PMID: 19657377, Table 1) in prostate cancer. In addition to chromosomal rearrangement, this gene is overexpressed in prostate cancer, melanoma and gastrointestinal stromal tumor. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous inactivation of this gene leads to premature death, ataxia, impaired limb coordination, defects in muscle innervation, muscle spindle differentiation and sensory-motor connectivity, deficient golgi tendon organs, and absence of Pacinian corpuscles and their afferents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik T C 9: 40,051,450 noncoding transcript Het
Actrt2 A C 4: 154,667,569 S37A possibly damaging Het
Adcy7 T C 8: 88,314,114 I327T probably damaging Het
Ankrd13b A G 11: 77,473,235 probably benign Het
Arap1 A C 7: 101,388,644 I237L probably benign Het
Arhgap17 A T 7: 123,303,748 Y359N probably benign Het
Atad1 A G 19: 32,674,302 M343T probably benign Het
Cacna1b A T 2: 24,719,952 I392N probably damaging Het
Cacna1c A G 6: 118,597,969 S1914P probably benign Het
Cd300a G T 11: 114,894,751 R174L probably benign Het
Dip2a G A 10: 76,299,997 P356L probably damaging Het
Dsg1c T C 18: 20,272,379 L283P probably damaging Het
Dusp1 T C 17: 26,508,217 N36S probably benign Het
Ercc3 C A 18: 32,269,864 P776Q probably damaging Het
Fa2h C G 8: 111,349,237 M251I probably benign Het
Flg2 A G 3: 93,200,812 D49G probably damaging Het
Fras1 A G 5: 96,741,025 E2810G probably damaging Het
Fuk T C 8: 110,883,867 E968G possibly damaging Het
Gabbr1 T C 17: 37,055,913 F343S possibly damaging Het
Gdf2 A G 14: 33,945,307 T329A probably benign Het
Hcn4 T A 9: 58,824,275 I255N unknown Het
Hk3 T G 13: 55,011,011 D485A probably damaging Het
Hook3 T C 8: 26,072,291 T249A probably benign Het
Kcp C T 6: 29,498,520 probably benign Het
Kifc2 G T 15: 76,666,281 R515L possibly damaging Het
Kiss1r A G 10: 79,920,750 Y142C probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klrb1a T A 6: 128,619,163 I72L probably benign Het
Lep T A 6: 29,070,863 F62Y probably damaging Het
Lrtm1 A G 14: 29,021,844 T90A probably benign Het
Mug1 A T 6: 121,888,913 D1472V probably benign Het
Ncor2 G T 5: 125,026,930 P1988Q probably benign Het
Nlrp4a C T 7: 26,450,492 S508L probably benign Het
Obp2b T A 2: 25,737,143 D29E probably benign Het
Olfr1123 G A 2: 87,418,668 V207M possibly damaging Het
Olfr1214 A G 2: 88,988,100 L34P possibly damaging Het
Olfr1224-ps1 A T 2: 89,156,457 C239* probably null Het
Olfr725 T C 14: 50,035,288 I38M possibly damaging Het
Olfr803 A G 10: 129,691,732 I103T probably damaging Het
Otof A G 5: 30,370,139 S1985P probably damaging Het
Oxct2a A T 4: 123,323,093 V165E probably damaging Het
Papd5 C A 8: 88,200,023 H20Q possibly damaging Het
Pcdhgb7 T C 18: 37,753,097 V440A possibly damaging Het
Pelp1 C A 11: 70,401,661 G211C probably damaging Het
Phox2a A G 7: 101,822,105 H268R probably benign Het
Pik3c2g T C 6: 139,896,257 probably null Het
Pramel1 T A 4: 143,398,586 M360K probably benign Het
Rbm6 C T 9: 107,852,657 R132K probably damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc45a1 T C 4: 150,638,270 T386A probably damaging Het
Smad2 A G 18: 76,288,053 Y151C probably damaging Het
Sptbn2 G A 19: 4,750,082 G2188D probably benign Het
Sugt1 G A 14: 79,602,901 probably null Het
Tctn3 T C 19: 40,607,241 S367G probably benign Het
Tead1 G T 7: 112,861,545 D219Y probably damaging Het
Tenm2 G T 11: 36,047,201 Y1548* probably null Het
Tenm3 T A 8: 48,229,198 I2466F possibly damaging Het
Tgm2 G A 2: 158,129,438 P294S probably damaging Het
Tns2 T C 15: 102,111,453 S585P probably damaging Het
Ttc41 A G 10: 86,730,942 K491E probably benign Het
Ttn G A 2: 76,791,551 T15549I probably damaging Het
Vmn1r157 T C 7: 22,761,758 L21P probably damaging Het
Vmn2r81 A G 10: 79,247,986 M65V probably benign Het
Wdr34 T A 2: 30,032,363 probably benign Het
Zcchc14 T C 8: 121,618,694 probably benign Het
Other mutations in Etv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Etv1 APN 12 38781792 splice site probably benign
IGL01376:Etv1 APN 12 38857040 missense probably damaging 1.00
IGL01387:Etv1 APN 12 38861327 missense probably damaging 0.99
IGL01936:Etv1 APN 12 38835061 splice site probably benign
IGL02388:Etv1 APN 12 38781799 missense possibly damaging 0.62
IGL02933:Etv1 APN 12 38781833 missense probably benign 0.22
R0844:Etv1 UTSW 12 38861354 missense probably damaging 1.00
R0993:Etv1 UTSW 12 38827864 missense probably damaging 1.00
R1187:Etv1 UTSW 12 38865564 missense probably damaging 1.00
R1710:Etv1 UTSW 12 38852262 missense probably benign 0.18
R2094:Etv1 UTSW 12 38835116 missense probably null 1.00
R2879:Etv1 UTSW 12 38783810 splice site probably null
R3607:Etv1 UTSW 12 38831086 missense probably damaging 1.00
R4353:Etv1 UTSW 12 38857106 missense probably damaging 1.00
R4646:Etv1 UTSW 12 38865686 missense possibly damaging 0.94
R4678:Etv1 UTSW 12 38835220 missense probably damaging 1.00
R4768:Etv1 UTSW 12 38827793 missense probably damaging 1.00
R4812:Etv1 UTSW 12 38861288 missense probably damaging 1.00
R4877:Etv1 UTSW 12 38831293 unclassified probably null
R5024:Etv1 UTSW 12 38854234 splice site probably null
R5936:Etv1 UTSW 12 38835210 missense probably damaging 1.00
R6085:Etv1 UTSW 12 38854195 missense probably damaging 1.00
R6167:Etv1 UTSW 12 38865641 missense possibly damaging 0.88
R6709:Etv1 UTSW 12 38783797 missense possibly damaging 0.93
R7046:Etv1 UTSW 12 38784370 intron probably null
R7243:Etv1 UTSW 12 38857046 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- TTGGAGGCCCCACTGAAAATG -3'
(R):5'- TTGGGGACATTGGTCAAGCAC -3'

Sequencing Primer
(F):5'- GGAGGCCCCACTGAAAATGTTTTC -3'
(R):5'- GACATTGGTCAAGCACTCTGC -3'
Posted On2016-07-06