Incidental Mutation 'R5179:Sos2'
ID399412
Institutional Source Beutler Lab
Gene Symbol Sos2
Ensembl Gene ENSMUSG00000034801
Gene NameSOS Ras/Rho guanine nucleotide exchange factor 2
Synonyms
MMRRC Submission 042759-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5179 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location69583762-69681852 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 69650728 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 73 (R73*)
Ref Sequence ENSEMBL: ENSMUSP00000138793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035773] [ENSMUST00000182396] [ENSMUST00000183277]
PDB Structure
ORIENTATION OF PEPTIDE FRAGMENTS FROM SOS PROTEINS BOUND TO THE N-TERMINAL SH3 DOMAIN OF GRB2 DETERMINED BY NMR SPECTROSCOPY [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000035773
AA Change: R73*
SMART Domains Protein: ENSMUSP00000044866
Gene: ENSMUSG00000034801
AA Change: R73*

DomainStartEndE-ValueType
Pfam:Histone 54 169 3.7e-13 PFAM
RhoGEF 203 388 1.98e-35 SMART
PH 443 547 1.54e-14 SMART
RasGEFN 595 740 5.8e-52 SMART
RasGEF 775 1019 2.51e-92 SMART
low complexity region 1079 1099 N/A INTRINSIC
low complexity region 1144 1152 N/A INTRINSIC
low complexity region 1173 1192 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
low complexity region 1254 1269 N/A INTRINSIC
low complexity region 1276 1292 N/A INTRINSIC
low complexity region 1301 1309 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000182396
AA Change: R73*
SMART Domains Protein: ENSMUSP00000138589
Gene: ENSMUSG00000034801
AA Change: R73*

DomainStartEndE-ValueType
Pfam:Histone 97 169 1e-9 PFAM
Pfam:RhoGEF 203 344 1.6e-12 PFAM
PH 410 514 1.54e-14 SMART
RasGEFN 562 707 5.8e-52 SMART
RasGEF 742 986 2.51e-92 SMART
low complexity region 1046 1066 N/A INTRINSIC
low complexity region 1111 1119 N/A INTRINSIC
low complexity region 1140 1159 N/A INTRINSIC
low complexity region 1167 1192 N/A INTRINSIC
low complexity region 1221 1236 N/A INTRINSIC
low complexity region 1243 1259 N/A INTRINSIC
low complexity region 1268 1276 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000183277
AA Change: R73*
SMART Domains Protein: ENSMUSP00000138793
Gene: ENSMUSG00000034801
AA Change: R73*

DomainStartEndE-ValueType
Pfam:Histone 97 169 8.9e-11 PFAM
RhoGEF 203 388 1.98e-35 SMART
PH 443 547 1.54e-14 SMART
RasGEFN 595 740 5.8e-52 SMART
RasGEF 775 1019 2.51e-92 SMART
low complexity region 1079 1099 N/A INTRINSIC
low complexity region 1144 1152 N/A INTRINSIC
low complexity region 1173 1192 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
low complexity region 1254 1269 N/A INTRINSIC
low complexity region 1276 1292 N/A INTRINSIC
low complexity region 1301 1309 N/A INTRINSIC
Meta Mutation Damage Score 0.594 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulatory protein that is involved in the positive regulation of ras proteins. Mutations in this gene are associated with Noonan Syndrome-9. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no discernable phenotype; mice are viable and fertile with normal embryonic and adult histopathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B9d2 C A 7: 25,681,401 H5Q probably damaging Het
Bhlhe40 T C 6: 108,665,208 I371T possibly damaging Het
Bmp8a C T 4: 123,313,301 R389H probably damaging Het
Cc2d2a T A 5: 43,688,221 N326K possibly damaging Het
Ccdc154 A G 17: 25,171,163 N545S probably benign Het
Ccser2 A T 14: 36,879,351 S359T possibly damaging Het
Cd22 T A 7: 30,875,874 T248S possibly damaging Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dnhd1 T C 7: 105,714,552 I4107T probably damaging Het
Egf T A 3: 129,686,287 H488L probably damaging Het
Epb41l4b A G 4: 57,063,181 V503A probably benign Het
Exd2 G T 12: 80,484,344 W105L probably damaging Het
Flrt2 A T 12: 95,780,347 R486S probably benign Het
Gadl1 C A 9: 115,960,380 C251* probably null Het
Ifit2 C A 19: 34,573,576 P172Q probably damaging Het
Incenp G C 19: 9,894,909 Q62E unknown Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lrg1 A G 17: 56,120,795 L59P possibly damaging Het
Luc7l3 T C 11: 94,300,053 E145G possibly damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Ndst3 A G 3: 123,552,532 S698P probably damaging Het
Nploc4 T C 11: 120,408,856 D346G probably benign Het
Olfr504 T C 7: 108,565,226 I190V probably benign Het
Olfr734 G A 14: 50,320,536 Q100* probably null Het
Osbpl8 T G 10: 111,272,164 D298E probably benign Het
Pcna-ps2 T C 19: 9,283,527 L50P probably damaging Het
Ptgir C T 7: 16,907,328 P182S probably damaging Het
Rictor A G 15: 6,795,940 Y1653C probably damaging Het
Sgcd T A 11: 46,980,884 E208V probably benign Het
Slc7a8 A T 14: 54,724,832 C448* probably null Het
Tecpr2 A G 12: 110,944,693 T1055A possibly damaging Het
Usp47 T C 7: 112,093,432 Y1014H probably damaging Het
Vmn2r6 A T 3: 64,537,990 F682L probably benign Het
Other mutations in Sos2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Sos2 APN 12 69616849 splice site probably benign
IGL01348:Sos2 APN 12 69618092 missense probably damaging 0.99
IGL01360:Sos2 APN 12 69590800 missense probably benign 0.00
IGL01586:Sos2 APN 12 69607398 missense probably damaging 1.00
IGL01721:Sos2 APN 12 69603867 missense probably damaging 0.99
IGL02024:Sos2 APN 12 69618048 splice site probably benign
IGL02347:Sos2 APN 12 69596746 missense probably benign
IGL02419:Sos2 APN 12 69616990 missense probably benign
IGL02684:Sos2 APN 12 69596666 missense probably damaging 1.00
IGL02719:Sos2 APN 12 69617184 missense probably benign 0.00
IGL03099:Sos2 APN 12 69616359 missense probably damaging 1.00
PIT4131001:Sos2 UTSW 12 69618077 missense probably benign
R0038:Sos2 UTSW 12 69596693 missense probably damaging 1.00
R0233:Sos2 UTSW 12 69617330 missense probably benign 0.00
R0233:Sos2 UTSW 12 69617330 missense probably benign 0.00
R0326:Sos2 UTSW 12 69635685 missense probably damaging 1.00
R1386:Sos2 UTSW 12 69614658 missense probably damaging 1.00
R1472:Sos2 UTSW 12 69585316 unclassified probably null
R1534:Sos2 UTSW 12 69616955 missense probably damaging 1.00
R1861:Sos2 UTSW 12 69617363 missense probably damaging 1.00
R1934:Sos2 UTSW 12 69648541 missense probably damaging 0.99
R1964:Sos2 UTSW 12 69616862 missense possibly damaging 0.51
R2402:Sos2 UTSW 12 69596799 missense possibly damaging 0.95
R2516:Sos2 UTSW 12 69650659 missense probably damaging 0.99
R2571:Sos2 UTSW 12 69635718 missense possibly damaging 0.95
R3423:Sos2 UTSW 12 69603553 missense probably damaging 1.00
R4435:Sos2 UTSW 12 69614699 missense possibly damaging 0.79
R4508:Sos2 UTSW 12 69635661 nonsense probably null
R4595:Sos2 UTSW 12 69616889 missense probably damaging 1.00
R4606:Sos2 UTSW 12 69614606 intron probably benign
R4691:Sos2 UTSW 12 69616328 missense probably damaging 1.00
R4716:Sos2 UTSW 12 69607371 missense probably benign 0.04
R4863:Sos2 UTSW 12 69640154 missense probably benign 0.04
R5319:Sos2 UTSW 12 69627284 missense probably benign 0.22
R5694:Sos2 UTSW 12 69590915 missense probably damaging 0.96
R5877:Sos2 UTSW 12 69596795 missense probably damaging 1.00
R6363:Sos2 UTSW 12 69632111 missense probably benign 0.00
R6465:Sos2 UTSW 12 69596775 missense probably benign 0.01
R6817:Sos2 UTSW 12 69618161 missense probably benign 0.32
R6822:Sos2 UTSW 12 69650649 missense probably damaging 1.00
R7015:Sos2 UTSW 12 69585235 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- CAGGGTATCACTCATGCAAAGC -3'
(R):5'- GATGTCTGCCATGACTGGTG -3'

Sequencing Primer
(F):5'- TGCAAAGCATATCACTGACACAC -3'
(R):5'- GAGACTGATCAGGTTGAGTTT -3'
Posted On2016-07-06