Incidental Mutation 'R5255:Esrrg'
ID 399439
Institutional Source Beutler Lab
Gene Symbol Esrrg
Ensembl Gene ENSMUSG00000026610
Gene Name estrogen-related receptor gamma
Synonyms ERR3, estrogen-related receptor 3, Errg, NR3B3
MMRRC Submission 042826-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5255 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 187340988-187947082 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 187878555 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 189 (R189H)
Ref Sequence ENSEMBL: ENSMUSP00000106564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027906] [ENSMUST00000110938] [ENSMUST00000110939]
AlphaFold P62509
Predicted Effect probably damaging
Transcript: ENSMUST00000027906
AA Change: R212H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027906
Gene: ENSMUSG00000026610
AA Change: R212H

DomainStartEndE-ValueType
low complexity region 57 70 N/A INTRINSIC
ZnF_C4 125 196 4.04e-40 SMART
Blast:HOLI 203 233 5e-6 BLAST
HOLI 270 428 1.64e-40 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110938
AA Change: R189H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106563
Gene: ENSMUSG00000026610
AA Change: R189H

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
ZnF_C4 102 173 4.04e-40 SMART
Blast:HOLI 180 210 4e-6 BLAST
HOLI 247 405 1.64e-40 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110939
AA Change: R189H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106564
Gene: ENSMUSG00000026610
AA Change: R189H

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
ZnF_C4 102 173 4.04e-40 SMART
Blast:HOLI 180 210 4e-6 BLAST
HOLI 247 405 1.64e-40 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the estrogen receptor-related receptor (ESRR) family, which belongs to the nuclear hormone receptor superfamily. All members of the ESRR family share an almost identical DNA binding domain, which is composed of two C4-type zinc finger motifs. The ESRR members are orphan nuclear receptors; they bind to the estrogen response element and steroidogenic factor 1 response element, and activate genes controlled by both response elements in the absence of any ligands. The ESRR family is closely related to the estrogen receptor (ER) family. They share target genes, co-regulators and promoters, and by targeting the same set of genes, the ESRRs seem to interfere with the ER-mediated estrogen response in various ways. It has been reported that the family member encoded by this gene functions as a transcriptional activator of DNA cytosine-5-methyltransferases 1 (Dnmt1) expression by direct binding to its response elements in the DNMT1 promoters, modulates cell proliferation and estrogen signaling in breast cancer, and negatively regulates bone morphogenetic protein 2-induced osteoblast differentiation and bone formation. Multiple alternatively spliced transcript variants have been identified, which mainly differ at the 5' end and some of which encode protein isoforms differing in the N-terminal region. [provided by RefSeq, Aug 2011]
PHENOTYPE: Nullizygous mutations lead to postnatal lethality. Homozygotes for a null allele show reduced birth weight, fasting hyperlactatemia, altered electrocardiograms and mitochondrial function, and agenesis of the renal papilla. Surviving homozygotes for a different null allele exhibit hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 A T 17: 36,270,629 (GRCm39) probably null Het
Abr T A 11: 76,346,509 (GRCm39) E434V probably damaging Het
Acaca T A 11: 84,202,133 (GRCm39) L197Q probably damaging Het
Acot10 A G 15: 20,666,018 (GRCm39) I241T probably benign Het
Acp6 T C 3: 97,075,312 (GRCm39) V182A probably benign Het
Ahnak2 G A 12: 112,739,812 (GRCm39) T1420I possibly damaging Het
Akr1c6 A T 13: 4,497,018 (GRCm39) K153N probably benign Het
Ank3 T C 10: 69,721,030 (GRCm39) L600P probably damaging Het
Arhgef1 G A 7: 24,624,447 (GRCm39) A824T probably damaging Het
B230307C23Rik T A 16: 97,809,891 (GRCm39) N22K possibly damaging Het
Btn1a1 A G 13: 23,648,324 (GRCm39) probably benign Het
Cenpf G A 1: 189,404,824 (GRCm39) T352I possibly damaging Het
Ces4a C A 8: 105,869,121 (GRCm39) F185L probably benign Het
Clybl A C 14: 122,621,691 (GRCm39) E293A probably benign Het
Cobl A G 11: 12,325,825 (GRCm39) W217R probably damaging Het
D430041D05Rik T C 2: 104,086,945 (GRCm39) N677S probably benign Het
Ddx51 C A 5: 110,803,908 (GRCm39) T390N possibly damaging Het
Drd5 T G 5: 38,477,310 (GRCm39) V101G probably damaging Het
Elmo3 C T 8: 106,033,985 (GRCm39) P244L probably benign Het
Fxr2 A G 11: 69,534,667 (GRCm39) T183A probably benign Het
Gjd4 T C 18: 9,280,613 (GRCm39) H155R probably benign Het
Hivep2 T A 10: 14,007,011 (GRCm39) probably null Het
Ints10 T C 8: 69,246,624 (GRCm39) probably benign Het
Kank4 T C 4: 98,667,209 (GRCm39) T413A probably benign Het
Mapkbp1 T C 2: 119,847,735 (GRCm39) V568A probably damaging Het
Mobp A G 9: 119,997,419 (GRCm39) probably benign Het
Mpst A G 15: 78,294,708 (GRCm39) S147G probably benign Het
Myo5b A T 18: 74,795,741 (GRCm39) Y559F possibly damaging Het
Nceh1 T C 3: 27,237,288 (GRCm39) I21T probably damaging Het
Or4f7 T C 2: 111,644,523 (GRCm39) K183E probably benign Het
Phf8-ps A T 17: 33,285,739 (GRCm39) C354* probably null Het
Ralgps1 A T 2: 33,166,171 (GRCm39) V126E probably damaging Het
Rnls A G 19: 33,359,823 (GRCm39) V115A probably damaging Het
Scn1a A T 2: 66,108,013 (GRCm39) V1554D probably damaging Het
Slc16a11 T A 11: 70,106,258 (GRCm39) D165E probably damaging Het
Slc16a5 A G 11: 115,353,501 (GRCm39) T23A probably benign Het
Slc22a30 G A 19: 8,321,757 (GRCm39) Q436* probably null Het
Slc3a1 A T 17: 85,335,881 (GRCm39) probably null Het
Slitrk6 A T 14: 110,987,185 (GRCm39) *841K probably null Het
Syngr1 A G 15: 79,975,647 (GRCm39) Y18C possibly damaging Het
Tarbp1 T G 8: 127,155,709 (GRCm39) D1343A probably benign Het
Vac14 T A 8: 111,360,961 (GRCm39) I177N probably damaging Het
Vmn1r218 A T 13: 23,320,881 (GRCm39) D76V possibly damaging Het
Wdr75 T A 1: 45,838,277 (GRCm39) I62N probably damaging Het
Zfp12 A T 5: 143,226,134 (GRCm39) I68L probably null Het
Zswim8 T A 14: 20,771,719 (GRCm39) Y1551N probably damaging Het
Other mutations in Esrrg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Esrrg APN 1 187,943,107 (GRCm39) missense probably damaging 1.00
IGL01635:Esrrg APN 1 187,930,797 (GRCm39) missense probably damaging 1.00
IGL01642:Esrrg APN 1 187,943,112 (GRCm39) missense probably benign 0.01
IGL02740:Esrrg APN 1 187,930,938 (GRCm39) missense probably benign 0.04
IGL03126:Esrrg APN 1 187,730,184 (GRCm39) intron probably benign
IGL03391:Esrrg APN 1 187,882,420 (GRCm39) missense possibly damaging 0.70
R0395:Esrrg UTSW 1 187,930,832 (GRCm39) missense probably damaging 1.00
R0645:Esrrg UTSW 1 187,775,538 (GRCm39) missense probably benign 0.00
R1593:Esrrg UTSW 1 187,798,582 (GRCm39) missense possibly damaging 0.94
R1700:Esrrg UTSW 1 187,775,850 (GRCm39) missense probably damaging 1.00
R1855:Esrrg UTSW 1 187,943,295 (GRCm39) missense probably damaging 1.00
R3552:Esrrg UTSW 1 187,882,387 (GRCm39) missense probably benign 0.05
R3605:Esrrg UTSW 1 187,943,299 (GRCm39) missense possibly damaging 0.74
R4384:Esrrg UTSW 1 187,775,908 (GRCm39) missense probably damaging 1.00
R5443:Esrrg UTSW 1 187,775,622 (GRCm39) missense possibly damaging 0.78
R5511:Esrrg UTSW 1 187,943,304 (GRCm39) missense probably damaging 1.00
R5516:Esrrg UTSW 1 187,930,927 (GRCm39) missense possibly damaging 0.56
R5543:Esrrg UTSW 1 187,882,451 (GRCm39) missense probably damaging 0.96
R5686:Esrrg UTSW 1 187,882,395 (GRCm39) missense probably benign 0.24
R5990:Esrrg UTSW 1 187,930,995 (GRCm39) missense probably damaging 1.00
R6030:Esrrg UTSW 1 187,930,904 (GRCm39) missense probably benign 0.04
R6030:Esrrg UTSW 1 187,930,904 (GRCm39) missense probably benign 0.04
R7058:Esrrg UTSW 1 187,882,503 (GRCm39) missense probably damaging 1.00
R7487:Esrrg UTSW 1 187,878,620 (GRCm39) missense probably benign 0.03
R8512:Esrrg UTSW 1 187,775,777 (GRCm39) nonsense probably null
R8735:Esrrg UTSW 1 187,933,205 (GRCm39) intron probably benign
R8973:Esrrg UTSW 1 187,930,947 (GRCm39) missense possibly damaging 0.79
R8986:Esrrg UTSW 1 187,943,104 (GRCm39) missense possibly damaging 0.60
R9114:Esrrg UTSW 1 187,878,606 (GRCm39) missense possibly damaging 0.75
R9114:Esrrg UTSW 1 187,878,605 (GRCm39) missense probably benign 0.01
R9483:Esrrg UTSW 1 187,930,848 (GRCm39) missense probably damaging 0.97
R9760:Esrrg UTSW 1 187,775,569 (GRCm39) missense probably benign
Z1088:Esrrg UTSW 1 187,882,415 (GRCm39) missense probably benign 0.04
Z1177:Esrrg UTSW 1 187,775,752 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCATACTTTTCAAACACTGGC -3'
(R):5'- TTTCCTTGGACTCAGAAGGGAC -3'

Sequencing Primer
(F):5'- CACTGGCAATTTTGATACAGCC -3'
(R):5'- GACGGGCATGCCAACACTAG -3'
Posted On 2016-07-06