Incidental Mutation 'R5255:Fxr2'
ID399500
Institutional Source Beutler Lab
Gene Symbol Fxr2
Ensembl Gene ENSMUSG00000018765
Gene Namefragile X mental retardation, autosomal homolog 2
SynonymsFxr2h
MMRRC Submission 042826-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.684) question?
Stock #R5255 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69632990-69653297 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69643841 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 183 (T183A)
Ref Sequence ENSEMBL: ENSMUSP00000018909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018909]
Predicted Effect probably benign
Transcript: ENSMUST00000018909
AA Change: T183A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000018909
Gene: ENSMUSG00000018765
AA Change: T183A

DomainStartEndE-ValueType
Pfam:Agenet 72 130 1.3e-10 PFAM
KH 227 294 3.06e-3 SMART
KH 295 366 4.16e-5 SMART
low complexity region 368 380 N/A INTRINSIC
low complexity region 389 406 N/A INTRINSIC
low complexity region 423 442 N/A INTRINSIC
low complexity region 475 503 N/A INTRINSIC
Pfam:FXR_C1 504 579 2.5e-36 PFAM
low complexity region 586 599 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139605
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155513
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a RNA binding protein containing two KH domains and one RCG box, which is similar to FMRP and FXR1. It associates with polyribosomes, predominantly with 60S large ribosomal subunits. This encoded protein may self-associate or interact with FMRP and FXR1. It may have a role in the development of fragile X mental retardation syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit hyperactivity, impaired Morris water task performance, and reductions in prepulse inhibition, contextual conditioned fear, and sensitivity to heat stimulus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,066,765 C354* probably null Het
Abcf1 A T 17: 35,959,737 probably null Het
Abr T A 11: 76,455,683 E434V probably damaging Het
Acaca T A 11: 84,311,307 L197Q probably damaging Het
Acot10 A G 15: 20,665,932 I241T probably benign Het
Acp6 T C 3: 97,167,996 V182A probably benign Het
Ahnak2 G A 12: 112,773,378 T1420I possibly damaging Het
Akr1c6 A T 13: 4,447,019 K153N probably benign Het
Ank3 T C 10: 69,885,200 L600P probably damaging Het
Arhgef1 G A 7: 24,925,022 A824T probably damaging Het
B230307C23Rik T A 16: 98,008,691 N22K possibly damaging Het
Btn1a1 A G 13: 23,464,154 probably benign Het
Cenpf G A 1: 189,672,627 T352I possibly damaging Het
Ces4a C A 8: 105,142,489 F185L probably benign Het
Clybl A C 14: 122,384,279 E293A probably benign Het
Cobl A G 11: 12,375,825 W217R probably damaging Het
D430041D05Rik T C 2: 104,256,600 N677S probably benign Het
Ddx51 C A 5: 110,656,042 T390N possibly damaging Het
Drd5 T G 5: 38,319,967 V101G probably damaging Het
Elmo3 C T 8: 105,307,353 P244L probably benign Het
Esrrg G A 1: 188,146,358 R189H probably damaging Het
Gjd4 T C 18: 9,280,613 H155R probably benign Het
Hivep2 T A 10: 14,131,267 probably null Het
Ints10 T C 8: 68,793,972 probably benign Het
Kank4 T C 4: 98,778,972 T413A probably benign Het
Mapkbp1 T C 2: 120,017,254 V568A probably damaging Het
Mobp A G 9: 120,168,353 probably benign Het
Mpst A G 15: 78,410,508 S147G probably benign Het
Myo5b A T 18: 74,662,670 Y559F possibly damaging Het
Nceh1 T C 3: 27,183,139 I21T probably damaging Het
Olfr1303 T C 2: 111,814,178 K183E probably benign Het
Ralgps1 A T 2: 33,276,159 V126E probably damaging Het
Rnls A G 19: 33,382,423 V115A probably damaging Het
Scn1a A T 2: 66,277,669 V1554D probably damaging Het
Slc16a11 T A 11: 70,215,432 D165E probably damaging Het
Slc16a5 A G 11: 115,462,675 T23A probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc3a1 A T 17: 85,028,453 probably null Het
Slitrk6 A T 14: 110,749,753 *841K probably null Het
Syngr1 A G 15: 80,091,446 Y18C possibly damaging Het
Tarbp1 T G 8: 126,428,970 D1343A probably benign Het
Vac14 T A 8: 110,634,329 I177N probably damaging Het
Vmn1r218 A T 13: 23,136,711 D76V possibly damaging Het
Wdr75 T A 1: 45,799,117 I62N probably damaging Het
Zfp12 A T 5: 143,240,379 I68L probably null Het
Zswim8 T A 14: 20,721,651 Y1551N probably damaging Het
Other mutations in Fxr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00469:Fxr2 APN 11 69642139 missense possibly damaging 0.77
IGL00595:Fxr2 APN 11 69649192 missense probably benign 0.01
IGL00659:Fxr2 APN 11 69640250 missense probably benign 0.12
IGL00921:Fxr2 APN 11 69652240 missense probably damaging 1.00
IGL01025:Fxr2 APN 11 69643887 missense probably damaging 1.00
IGL01154:Fxr2 APN 11 69641433 splice site probably benign
IGL01347:Fxr2 APN 11 69652288 missense probably benign 0.27
IGL01743:Fxr2 APN 11 69652622 missense possibly damaging 0.53
IGL01981:Fxr2 APN 11 69650502 missense possibly damaging 0.95
IGL02332:Fxr2 APN 11 69649838 critical splice donor site probably null
IGL02385:Fxr2 APN 11 69652269 missense possibly damaging 0.82
IGL03172:Fxr2 APN 11 69649839 critical splice donor site probably null
R0092:Fxr2 UTSW 11 69642146 splice site probably benign
R0720:Fxr2 UTSW 11 69639415 missense probably benign 0.03
R1112:Fxr2 UTSW 11 69652248 missense probably damaging 1.00
R1344:Fxr2 UTSW 11 69648884 missense possibly damaging 0.68
R1635:Fxr2 UTSW 11 69641313 missense possibly damaging 0.77
R1864:Fxr2 UTSW 11 69652277 missense probably benign 0.30
R1957:Fxr2 UTSW 11 69643940 missense probably benign 0.03
R1992:Fxr2 UTSW 11 69649833 missense possibly damaging 0.92
R2243:Fxr2 UTSW 11 69642070 missense possibly damaging 0.93
R2863:Fxr2 UTSW 11 69639427 missense probably damaging 1.00
R2865:Fxr2 UTSW 11 69639427 missense probably damaging 1.00
R5726:Fxr2 UTSW 11 69633346 missense probably benign 0.00
R5899:Fxr2 UTSW 11 69652685 missense probably damaging 1.00
R6045:Fxr2 UTSW 11 69651051 missense possibly damaging 0.90
R6146:Fxr2 UTSW 11 69641339 missense possibly damaging 0.82
R6149:Fxr2 UTSW 11 69649204 missense probably benign 0.05
R6195:Fxr2 UTSW 11 69652273 missense probably benign 0.30
R6622:Fxr2 UTSW 11 69641590 critical splice donor site probably null
R7381:Fxr2 UTSW 11 69642049 missense possibly damaging 0.89
R7382:Fxr2 UTSW 11 69641556 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGTCTCTAATGCTTCCATGGTG -3'
(R):5'- ACACAGGACTAATGACCTAGTAGC -3'

Sequencing Primer
(F):5'- CATCTATGTGAGGGTGTCAGATCTCC -3'
(R):5'- GGACTAATGACCTAGTAGCCTTTTC -3'
Posted On2016-07-06