Incidental Mutation 'R5177:Vmn2r79'
ID399590
Institutional Source Beutler Lab
Gene Symbol Vmn2r79
Ensembl Gene ENSMUSG00000090362
Gene Namevomeronasal 2, receptor 79
SynonymsEG621430
MMRRC Submission 042757-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R5177 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location86996465-87037968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87001969 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 192 (M192K)
Ref Sequence ENSEMBL: ENSMUSP00000132478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164462]
Predicted Effect probably damaging
Transcript: ENSMUST00000164462
AA Change: M192K

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132478
Gene: ENSMUSG00000090362
AA Change: M192K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 75 464 1.9e-31 PFAM
Pfam:NCD3G 506 559 3.1e-21 PFAM
Pfam:7tm_3 592 827 2.8e-53 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 97% (71/73)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,285,295 R575Q probably damaging Het
AI464131 C A 4: 41,498,407 E408* probably null Het
Arhgap22 T G 14: 33,366,693 V377G probably benign Het
Asic4 T C 1: 75,450,839 I3T probably damaging Het
Atp2b4 T C 1: 133,728,768 T715A probably benign Het
Ccdc180 A T 4: 45,917,508 H283L probably damaging Het
Cfb A G 17: 34,859,026 V976A probably damaging Het
Cltc T C 11: 86,705,163 T1250A probably damaging Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dcbld1 T A 10: 52,304,634 D131E probably damaging Het
Dmxl1 T C 18: 49,893,584 S1920P probably damaging Het
Dnajc13 G A 9: 104,230,986 H197Y probably benign Het
Dpy19l1 C T 9: 24,438,628 probably null Het
Ears2 A G 7: 122,044,460 probably benign Het
Epgn A C 5: 91,028,277 probably benign Het
Ern1 T C 11: 106,411,775 T418A probably benign Het
F12 G A 13: 55,420,168 P476S probably benign Het
Gal3st2c C T 1: 94,009,208 Q292* probably null Het
Galnt7 C A 8: 57,584,027 Q109H possibly damaging Het
Gimap1 G T 6: 48,743,098 G215W probably damaging Het
Gm28042 T A 2: 120,041,601 probably null Het
Gm5414 A G 15: 101,625,817 I284T possibly damaging Het
Hddc3 A G 7: 80,343,166 E10G probably damaging Het
Hmgxb3 T C 18: 61,172,194 K31E probably damaging Het
Hspg2 A C 4: 137,518,772 Y989S probably damaging Het
Kif12 G A 4: 63,167,904 T402M probably benign Het
Klhdc4 A T 8: 121,813,790 L115* probably null Het
Lama2 C T 10: 27,190,703 V1061M possibly damaging Het
Llgl1 C T 11: 60,712,007 T836I possibly damaging Het
Maats1 A G 16: 38,332,321 S176P probably benign Het
Map4k4 A G 1: 39,986,762 D304G probably damaging Het
Matn2 A G 15: 34,433,514 Q915R possibly damaging Het
Myo18a A G 11: 77,864,842 probably benign Het
Nbn A T 4: 15,965,132 probably null Het
Nek8 G A 11: 78,170,471 Q383* probably null Het
Nme7 T G 1: 164,380,676 Y304* probably null Het
Nol8 A T 13: 49,661,112 H214L probably benign Het
Nostrin A T 2: 69,175,754 I261F possibly damaging Het
Olfr46 A G 7: 140,610,189 T8A probably benign Het
Olfr592 A T 7: 103,187,503 I301L probably benign Het
Oprk1 T G 1: 5,602,674 C345G probably damaging Het
Polrmt T C 10: 79,737,476 S998G probably benign Het
Ppp1r12c T A 7: 4,484,496 R393* probably null Het
Prpf3 T A 3: 95,849,724 probably benign Het
Rabl6 T C 2: 25,585,373 M563V probably benign Het
Rasa2 C A 9: 96,544,791 E775* probably null Het
Rc3h1 G T 1: 160,951,652 V552L probably damaging Het
Rhot1 A T 11: 80,246,766 N365Y possibly damaging Het
Rimbp3 G A 16: 17,209,917 V402M possibly damaging Het
Rusc2 A T 4: 43,421,805 probably null Het
Slc25a11 T C 11: 70,645,817 E141G probably damaging Het
Slc34a1 A T 13: 55,401,162 I142F probably damaging Het
Socs6 A C 18: 88,869,380 Y470* probably null Het
Sox12 A T 2: 152,397,178 L174Q unknown Het
Srl A G 16: 4,496,403 probably null Het
Tacc1 A T 8: 25,201,221 V22E probably damaging Het
Thsd7a A T 6: 12,379,583 C947* probably null Het
Tlr12 A C 4: 128,618,376 V27G probably damaging Het
Tmprss4 C A 9: 45,173,962 V398L probably benign Het
Trip6 T C 5: 137,312,172 D270G probably damaging Het
Uba5 T G 9: 104,049,298 N355T probably benign Het
Ubr5 A G 15: 38,006,517 Y1171H probably benign Het
Uhrf1bp1 T C 17: 27,885,018 L464P possibly damaging Het
Vmn2r57 A G 7: 41,400,240 I695T probably benign Het
Vmn2r68 T A 7: 85,221,991 I695L probably damaging Het
Vps16 G T 2: 130,443,368 E782* probably null Het
Zfp783 A G 6: 47,946,803 noncoding transcript Het
Other mutations in Vmn2r79
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01401:Vmn2r79 APN 7 87037273 missense probably benign 0.01
IGL01675:Vmn2r79 APN 7 86996648 missense probably benign 0.01
IGL01760:Vmn2r79 APN 7 87002158 missense probably benign
IGL01834:Vmn2r79 APN 7 87037146 missense probably benign 0.01
IGL01843:Vmn2r79 APN 7 87037277 missense probably damaging 1.00
IGL01914:Vmn2r79 APN 7 87037363 missense probably benign 0.14
IGL01980:Vmn2r79 APN 7 87037082 missense possibly damaging 0.49
IGL02438:Vmn2r79 APN 7 87002536 missense probably damaging 0.98
IGL02740:Vmn2r79 APN 7 87004158 missense probably benign 0.00
IGL03052:Vmn2r79 UTSW 7 87003591 missense probably benign 0.00
R0096:Vmn2r79 UTSW 7 87037319 missense probably damaging 1.00
R0096:Vmn2r79 UTSW 7 87037319 missense probably damaging 1.00
R0270:Vmn2r79 UTSW 7 87003386 missense probably benign 0.00
R0336:Vmn2r79 UTSW 7 87002079 missense probably benign 0.15
R0418:Vmn2r79 UTSW 7 87002403 missense probably benign 0.18
R1070:Vmn2r79 UTSW 7 87003473 missense probably damaging 1.00
R1234:Vmn2r79 UTSW 7 87004099 missense possibly damaging 0.71
R1459:Vmn2r79 UTSW 7 87037794 missense probably benign 0.01
R1513:Vmn2r79 UTSW 7 87037444 missense probably benign 0.01
R1624:Vmn2r79 UTSW 7 87004039 critical splice acceptor site probably null
R1633:Vmn2r79 UTSW 7 87037834 missense possibly damaging 0.52
R1676:Vmn2r79 UTSW 7 87002631 missense probably benign
R1781:Vmn2r79 UTSW 7 87002347 missense probably benign 0.00
R1794:Vmn2r79 UTSW 7 87001413 missense probably benign 0.37
R1823:Vmn2r79 UTSW 7 87037872 missense probably damaging 1.00
R2013:Vmn2r79 UTSW 7 87004081 missense possibly damaging 0.50
R2018:Vmn2r79 UTSW 7 87002426 missense probably benign 0.07
R2019:Vmn2r79 UTSW 7 87002426 missense probably benign 0.07
R2177:Vmn2r79 UTSW 7 86996631 missense possibly damaging 0.94
R2984:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R3719:Vmn2r79 UTSW 7 87002037 missense probably benign 0.05
R3798:Vmn2r79 UTSW 7 87002194 missense possibly damaging 0.88
R3969:Vmn2r79 UTSW 7 87003593 missense probably damaging 1.00
R4182:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4183:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4245:Vmn2r79 UTSW 7 87002416 missense possibly damaging 0.73
R4301:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4391:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4393:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4394:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4396:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4397:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4592:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R4697:Vmn2r79 UTSW 7 87037960 missense probably damaging 0.98
R4897:Vmn2r79 UTSW 7 87001467 missense probably benign
R5016:Vmn2r79 UTSW 7 87037340 missense probably benign 0.00
R5058:Vmn2r79 UTSW 7 87002215 missense probably damaging 0.98
R6078:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R6079:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R6138:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R6257:Vmn2r79 UTSW 7 87002570 missense probably benign 0.27
R6260:Vmn2r79 UTSW 7 87037157 missense probably benign 0.00
R6307:Vmn2r79 UTSW 7 87037768 missense probably damaging 1.00
R6323:Vmn2r79 UTSW 7 87001314 missense probably benign 0.05
R6374:Vmn2r79 UTSW 7 87002290 missense probably benign 0.02
R6530:Vmn2r79 UTSW 7 87002044 missense possibly damaging 0.91
R6546:Vmn2r79 UTSW 7 87003533 missense probably benign 0.01
R6682:Vmn2r79 UTSW 7 87004162 missense possibly damaging 0.69
R6858:Vmn2r79 UTSW 7 87037372 missense probably benign
R6965:Vmn2r79 UTSW 7 87001892 missense probably benign 0.10
R7130:Vmn2r79 UTSW 7 87002266 missense not run
U15987:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
X0054:Vmn2r79 UTSW 7 87004062 missense probably benign 0.01
Z1088:Vmn2r79 UTSW 7 87002341 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTAGCACATTTTGATCTTAGACTG -3'
(R):5'- GACAATGACAACTTTTGCTGATGAC -3'

Sequencing Primer
(F):5'- TGATCTTAGACTGAGCACCATGC -3'
(R):5'- GACAACTTTTGCTGATGACATTGTG -3'
Posted On2016-07-06