Incidental Mutation 'R5177:Klhdc4'
ID399602
Institutional Source Beutler Lab
Gene Symbol Klhdc4
Ensembl Gene ENSMUSG00000040263
Gene Namekelch domain containing 4
Synonyms
MMRRC Submission 042757-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R5177 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location121796313-121829569 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 121813790 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 115 (L115*)
Ref Sequence ENSEMBL: ENSMUSP00000134474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045884] [ENSMUST00000127664] [ENSMUST00000174192] [ENSMUST00000174665] [ENSMUST00000174717]
Predicted Effect probably damaging
Transcript: ENSMUST00000045884
AA Change: F141L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000043439
Gene: ENSMUSG00000040263
AA Change: F141L

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
Pfam:Kelch_4 63 118 8.3e-11 PFAM
Pfam:Kelch_3 75 125 1.7e-9 PFAM
Pfam:Kelch_6 118 174 2.4e-9 PFAM
Pfam:Kelch_4 118 175 3e-8 PFAM
Pfam:Kelch_3 131 185 2e-8 PFAM
Pfam:Kelch_5 173 216 7.5e-9 PFAM
Pfam:Kelch_3 186 239 2.1e-6 PFAM
Pfam:Kelch_1 295 345 4.6e-6 PFAM
Pfam:Kelch_2 295 349 2.1e-7 PFAM
low complexity region 489 520 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174192
AA Change: F84L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134487
Gene: ENSMUSG00000040263
AA Change: F84L

DomainStartEndE-ValueType
Pfam:Kelch_3 32 70 1.5e-6 PFAM
Pfam:Kelch_6 61 117 1.9e-8 PFAM
Pfam:Kelch_4 61 118 6.9e-8 PFAM
Pfam:Kelch_3 74 128 4.6e-8 PFAM
Pfam:Kelch_5 116 159 1.4e-7 PFAM
Pfam:Kelch_4 119 172 2.2e-6 PFAM
Pfam:Kelch_3 129 182 7e-7 PFAM
Pfam:Kelch_2 238 292 1.8e-7 PFAM
low complexity region 432 463 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000174665
AA Change: L115*
SMART Domains Protein: ENSMUSP00000134474
Gene: ENSMUSG00000040263
AA Change: L115*

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
low complexity region 57 67 N/A INTRINSIC
low complexity region 104 114 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174709
Predicted Effect possibly damaging
Transcript: ENSMUST00000174717
AA Change: F141L

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134361
Gene: ENSMUSG00000040263
AA Change: F141L

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
Pfam:Kelch_4 63 117 1.4e-8 PFAM
Pfam:Kelch_3 75 127 9.6e-11 PFAM
Pfam:Kelch_4 118 170 2.3e-7 PFAM
Pfam:Kelch_6 118 174 9.3e-9 PFAM
low complexity region 191 202 N/A INTRINSIC
Pfam:Kelch_2 264 318 2e-7 PFAM
low complexity region 458 489 N/A INTRINSIC
Meta Mutation Damage Score 0.6348 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 97% (71/73)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,285,295 R575Q probably damaging Het
AI464131 C A 4: 41,498,407 E408* probably null Het
Arhgap22 T G 14: 33,366,693 V377G probably benign Het
Asic4 T C 1: 75,450,839 I3T probably damaging Het
Atp2b4 T C 1: 133,728,768 T715A probably benign Het
Ccdc180 A T 4: 45,917,508 H283L probably damaging Het
Cfb A G 17: 34,859,026 V976A probably damaging Het
Cltc T C 11: 86,705,163 T1250A probably damaging Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dcbld1 T A 10: 52,304,634 D131E probably damaging Het
Dmxl1 T C 18: 49,893,584 S1920P probably damaging Het
Dnajc13 G A 9: 104,230,986 H197Y probably benign Het
Dpy19l1 C T 9: 24,438,628 probably null Het
Ears2 A G 7: 122,044,460 probably benign Het
Epgn A C 5: 91,028,277 probably benign Het
Ern1 T C 11: 106,411,775 T418A probably benign Het
F12 G A 13: 55,420,168 P476S probably benign Het
Gal3st2c C T 1: 94,009,208 Q292* probably null Het
Galnt7 C A 8: 57,584,027 Q109H possibly damaging Het
Gimap1 G T 6: 48,743,098 G215W probably damaging Het
Gm28042 T A 2: 120,041,601 probably null Het
Gm5414 A G 15: 101,625,817 I284T possibly damaging Het
Hddc3 A G 7: 80,343,166 E10G probably damaging Het
Hmgxb3 T C 18: 61,172,194 K31E probably damaging Het
Hspg2 A C 4: 137,518,772 Y989S probably damaging Het
Kif12 G A 4: 63,167,904 T402M probably benign Het
Lama2 C T 10: 27,190,703 V1061M possibly damaging Het
Llgl1 C T 11: 60,712,007 T836I possibly damaging Het
Maats1 A G 16: 38,332,321 S176P probably benign Het
Map4k4 A G 1: 39,986,762 D304G probably damaging Het
Matn2 A G 15: 34,433,514 Q915R possibly damaging Het
Myo18a A G 11: 77,864,842 probably benign Het
Nbn A T 4: 15,965,132 probably null Het
Nek8 G A 11: 78,170,471 Q383* probably null Het
Nme7 T G 1: 164,380,676 Y304* probably null Het
Nol8 A T 13: 49,661,112 H214L probably benign Het
Nostrin A T 2: 69,175,754 I261F possibly damaging Het
Olfr46 A G 7: 140,610,189 T8A probably benign Het
Olfr592 A T 7: 103,187,503 I301L probably benign Het
Oprk1 T G 1: 5,602,674 C345G probably damaging Het
Polrmt T C 10: 79,737,476 S998G probably benign Het
Ppp1r12c T A 7: 4,484,496 R393* probably null Het
Prpf3 T A 3: 95,849,724 probably benign Het
Rabl6 T C 2: 25,585,373 M563V probably benign Het
Rasa2 C A 9: 96,544,791 E775* probably null Het
Rc3h1 G T 1: 160,951,652 V552L probably damaging Het
Rhot1 A T 11: 80,246,766 N365Y possibly damaging Het
Rimbp3 G A 16: 17,209,917 V402M possibly damaging Het
Rusc2 A T 4: 43,421,805 probably null Het
Slc25a11 T C 11: 70,645,817 E141G probably damaging Het
Slc34a1 A T 13: 55,401,162 I142F probably damaging Het
Socs6 A C 18: 88,869,380 Y470* probably null Het
Sox12 A T 2: 152,397,178 L174Q unknown Het
Srl A G 16: 4,496,403 probably null Het
Tacc1 A T 8: 25,201,221 V22E probably damaging Het
Thsd7a A T 6: 12,379,583 C947* probably null Het
Tlr12 A C 4: 128,618,376 V27G probably damaging Het
Tmprss4 C A 9: 45,173,962 V398L probably benign Het
Trip6 T C 5: 137,312,172 D270G probably damaging Het
Uba5 T G 9: 104,049,298 N355T probably benign Het
Ubr5 A G 15: 38,006,517 Y1171H probably benign Het
Uhrf1bp1 T C 17: 27,885,018 L464P possibly damaging Het
Vmn2r57 A G 7: 41,400,240 I695T probably benign Het
Vmn2r68 T A 7: 85,221,991 I695L probably damaging Het
Vmn2r79 T A 7: 87,001,969 M192K probably damaging Het
Vps16 G T 2: 130,443,368 E782* probably null Het
Zfp783 A G 6: 47,946,803 noncoding transcript Het
Other mutations in Klhdc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Klhdc4 APN 8 121821843 nonsense probably null
IGL01678:Klhdc4 APN 8 121796938 missense possibly damaging 0.73
kilimanjaro UTSW 8 121813790 nonsense probably null
R0577:Klhdc4 UTSW 8 121821351 missense probably damaging 0.99
R0881:Klhdc4 UTSW 8 121799487 nonsense probably null
R1710:Klhdc4 UTSW 8 121799487 nonsense probably null
R2993:Klhdc4 UTSW 8 121806581 nonsense probably null
R3028:Klhdc4 UTSW 8 121799549 missense probably damaging 1.00
R3109:Klhdc4 UTSW 8 121821334 missense probably damaging 1.00
R3711:Klhdc4 UTSW 8 121798055 missense probably benign
R4132:Klhdc4 UTSW 8 121798065 missense possibly damaging 0.79
R4601:Klhdc4 UTSW 8 121799527 missense probably damaging 1.00
R4644:Klhdc4 UTSW 8 121822000 intron probably benign
R4758:Klhdc4 UTSW 8 121798044 missense probably benign 0.00
R4999:Klhdc4 UTSW 8 121796603 missense probably benign 0.00
R5364:Klhdc4 UTSW 8 121806636 intron probably benign
R5475:Klhdc4 UTSW 8 121799572 missense possibly damaging 0.67
R5705:Klhdc4 UTSW 8 121804993 missense probably benign 0.01
R6248:Klhdc4 UTSW 8 121813768 missense probably damaging 1.00
R6326:Klhdc4 UTSW 8 121805054 missense probably damaging 1.00
R6626:Klhdc4 UTSW 8 121820162 missense probably benign 0.43
R7274:Klhdc4 UTSW 8 121799658 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATTCAGGCCCAACACTGCTC -3'
(R):5'- TCTAGAAGCTTCCCCTTGGAG -3'

Sequencing Primer
(F):5'- TCTTCCCGGCACACAGGAC -3'
(R):5'- TTCCCCTTGGAGGCAAGAGAC -3'
Posted On2016-07-06