Incidental Mutation 'R0455:Hdac2'
ID39963
Institutional Source Beutler Lab
Gene Symbol Hdac2
Ensembl Gene ENSMUSG00000019777
Gene Namehistone deacetylase 2
SynonymsYy1bp, D10Wsu179e
MMRRC Submission 038655-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0455 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location36974544-37001889 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 36991836 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 193 (R193C)
Ref Sequence ENSEMBL: ENSMUSP00000101149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019911] [ENSMUST00000105510]
Predicted Effect probably damaging
Transcript: ENSMUST00000019911
AA Change: R193C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019911
Gene: ENSMUSG00000019777
AA Change: R193C

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 19 321 2.5e-88 PFAM
low complexity region 392 403 N/A INTRINSIC
low complexity region 418 431 N/A INTRINSIC
low complexity region 448 469 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105510
AA Change: R193C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101149
Gene: ENSMUSG00000019777
AA Change: R193C

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 19 297 8.9e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128031
Meta Mutation Damage Score 0.696 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the histone deacetylase family. Histone deacetylases act via the formation of large multiprotein complexes, and are responsible for the deacetylation of lysine residues at the N-terminal regions of core histones (H2A, H2B, H3 and H4). This protein forms transcriptional repressor complexes by associating with many different proteins, including YY1, a mammalian zinc-finger transcription factor. Thus, it plays an important role in transcriptional regulation, cell cycle progression and developmental events. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic and postnatal lethality accompanied with a transient decrease in body size and increase in heart size and cardiomyocyte proliferation that is overcome by 2 months of age in surviving mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik C T 4: 103,230,983 G342D possibly damaging Het
Acvr2b C T 9: 119,432,609 R399W probably damaging Het
AI464131 G A 4: 41,499,538 R31* probably null Het
Atf6 A G 1: 170,834,923 V256A probably benign Het
Atp2b4 A T 1: 133,728,716 I732N probably damaging Het
C1qtnf9 A C 14: 60,772,371 Q25H probably damaging Het
Ccdc6 T A 10: 70,142,571 probably benign Het
Cds2 T C 2: 132,285,967 probably null Het
Chdh A G 14: 30,034,646 Y343C probably damaging Het
Col5a2 T C 1: 45,382,102 probably benign Het
Cts3 G A 13: 61,568,210 probably benign Het
Cyfip1 T A 7: 55,892,054 D362E probably benign Het
Dsg1b T A 18: 20,396,025 S273T probably benign Het
Dysf A T 6: 84,140,667 H1274L probably benign Het
Eva1c T C 16: 90,876,098 S187P probably benign Het
Fam126b T C 1: 58,534,479 probably benign Het
Fam13b G A 18: 34,445,528 probably benign Het
Fam172a T A 13: 77,834,713 probably benign Het
Fbn2 C T 18: 58,035,336 G2310S probably damaging Het
Fcna T C 2: 25,625,508 Y183C probably damaging Het
Fnta T C 8: 26,001,028 T263A probably benign Het
Gm94 T C 18: 43,781,244 D83G possibly damaging Het
Gnal C T 18: 67,135,649 probably benign Het
Grb7 T G 11: 98,452,188 S244A probably benign Het
Grm3 T C 5: 9,512,477 T458A probably benign Het
Ighmbp2 T C 19: 3,265,072 R783G probably benign Het
Inpp5j G T 11: 3,503,122 L43I possibly damaging Het
Itga11 A T 9: 62,696,961 T44S probably damaging Het
Itsn1 C T 16: 91,868,148 probably benign Het
Kdm6b G T 11: 69,406,996 C233* probably null Het
Lamb3 T C 1: 193,343,392 L1130P probably damaging Het
Lrch3 T C 16: 32,986,880 F508L probably damaging Het
Lrrd1 T A 5: 3,866,425 V814E probably benign Het
Megf10 C T 18: 57,252,982 P356S probably benign Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Nus1 T A 10: 52,430,094 V42E probably damaging Het
Olfr435 A C 6: 43,202,072 M143L probably benign Het
Olfr739 A G 14: 50,424,902 I128V possibly damaging Het
Padi3 T C 4: 140,795,713 N306S probably damaging Het
Pex13 T C 11: 23,655,949 S94G probably benign Het
Ppm1h G T 10: 122,802,324 Q166H probably benign Het
Ptafr A T 4: 132,580,085 Y262F probably benign Het
Rabgap1 T A 2: 37,487,120 D321E probably damaging Het
Samsn1 C T 16: 75,945,225 noncoding transcript Het
Scarb1 T C 5: 125,289,681 N63D probably damaging Het
Serpinb7 T C 1: 107,451,610 I249T possibly damaging Het
Srpr A G 9: 35,214,981 K490R probably benign Het
Sycn A G 7: 28,540,973 N22D probably benign Het
Tarbp1 C T 8: 126,440,873 A1067T probably benign Het
Tex14 A G 11: 87,514,305 D681G possibly damaging Het
Usp34 C T 11: 23,446,741 probably benign Het
Vmn2r107 T C 17: 20,374,823 probably benign Het
Vwde A T 6: 13,187,529 M653K probably benign Het
Wrap73 T A 4: 154,148,743 S125T possibly damaging Het
Other mutations in Hdac2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Hdac2 APN 10 36997071 missense probably damaging 1.00
IGL00827:Hdac2 APN 10 36997114 missense probably benign
IGL02971:Hdac2 APN 10 37000374 nonsense probably null
checkmate UTSW 10 36993899 missense probably benign
failure UTSW 10 36989184 missense probably benign 0.16
misstep UTSW 10 36986374 missense possibly damaging 0.59
R0123:Hdac2 UTSW 10 36989184 missense probably benign 0.16
R0134:Hdac2 UTSW 10 36989184 missense probably benign 0.16
R0167:Hdac2 UTSW 10 37000372 missense probably benign 0.04
R0225:Hdac2 UTSW 10 36989184 missense probably benign 0.16
R0480:Hdac2 UTSW 10 36974792 missense probably damaging 1.00
R0482:Hdac2 UTSW 10 36989134 intron probably benign
R0535:Hdac2 UTSW 10 36993899 missense probably benign
R1101:Hdac2 UTSW 10 36991809 missense probably damaging 1.00
R1297:Hdac2 UTSW 10 36986374 missense possibly damaging 0.59
R4839:Hdac2 UTSW 10 36997466 missense probably benign 0.04
R6109:Hdac2 UTSW 10 36986389 missense probably null 0.83
R6447:Hdac2 UTSW 10 36993816 missense possibly damaging 0.95
R6519:Hdac2 UTSW 10 36989256 missense probably damaging 1.00
R6893:Hdac2 UTSW 10 36997007 missense probably damaging 1.00
R7461:Hdac2 UTSW 10 36989236 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTACTCGATTGTCTTGGTAGCCCG -3'
(R):5'- CTGAACAACAAGCAGCATTCAGTGG -3'

Sequencing Primer
(F):5'- TCTTGGTAGCCCGAGGAGAC -3'
(R):5'- CTGCTCAACTAAGGTGAGGC -3'
Posted On2013-05-23