Incidental Mutation 'R5180:Vps45'
ID399692
Institutional Source Beutler Lab
Gene Symbol Vps45
Ensembl Gene ENSMUSG00000015747
Gene Namevacuolar protein sorting 45
SynonymsmVps45
MMRRC Submission 042760-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.877) question?
Stock #R5180 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location95999832-96058466 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96046371 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 223 (I223T)
Ref Sequence ENSEMBL: ENSMUSP00000015891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015891]
Predicted Effect possibly damaging
Transcript: ENSMUST00000015891
AA Change: I223T

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000015891
Gene: ENSMUSG00000015747
AA Change: I223T

DomainStartEndE-ValueType
Pfam:Sec1 23 546 3e-119 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131281
Meta Mutation Damage Score 0.258 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene is a member of the Sec1 domain family, and shows a high degree of sequence similarity to mouse, rat and yeast Vps45. The exact function of this gene is not known, but its high expression in peripheral blood mononuclear cells suggests a role in trafficking proteins, including inflammatory mediators. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,466,510 T4091A probably benign Het
Adgrv1 G A 13: 81,283,416 probably benign Het
Ago3 C T 4: 126,367,751 V435I probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ampd2 G T 3: 108,079,042 Q273K probably benign Het
Ankrd35 C A 3: 96,680,473 H109Q probably damaging Het
Atpaf2 A G 11: 60,405,869 L153S possibly damaging Het
C1qtnf7 G A 5: 43,615,814 V152M probably benign Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep295 C T 9: 15,332,120 C1680Y probably benign Het
Cyp4f15 A T 17: 32,690,740 I104F probably benign Het
Daam1 A G 12: 71,947,125 N434S unknown Het
Dab2ip C T 2: 35,720,491 P782L possibly damaging Het
Dhx34 C A 7: 16,205,480 G663* probably null Het
Dnah7a T C 1: 53,423,287 D3715G probably damaging Het
Dnajc11 C T 4: 151,969,939 R201C probably damaging Het
Erf A T 7: 25,246,265 I27N probably damaging Het
Fbxl7 T A 15: 26,543,421 Y380F probably damaging Het
Gm3336 A G 8: 70,720,461 probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm5134 T C 10: 75,976,366 Y152H probably damaging Het
Gm6899 A G 11: 26,593,795 probably benign Het
Gna11 T C 10: 81,544,873 K19E probably benign Het
Gpr15 C A 16: 58,717,885 L280F probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Ino80d C A 1: 63,086,329 probably benign Het
Irak3 T G 10: 120,145,782 K406T probably damaging Het
Kif15 G A 9: 122,999,210 C634Y probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Macrod2 A T 2: 140,395,716 E14V probably damaging Het
Matn3 T A 12: 8,955,374 D261E probably benign Het
Mdga1 A T 17: 29,857,736 probably benign Het
Natd1 G T 11: 60,913,656 R24S probably benign Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Olfr1453 A T 19: 13,027,412 S306T probably benign Het
Parp9 T A 16: 35,953,736 Y81* probably null Het
Pde4d A G 13: 109,740,473 N73S probably benign Het
Pigb A T 9: 73,034,590 I129N probably damaging Het
Plxnb1 C A 9: 109,111,693 probably null Het
Ppfibp1 G T 6: 147,027,321 R813L probably damaging Het
Ramp3 T A 11: 6,658,619 L16Q unknown Het
Slc35a4 T C 18: 36,682,635 S173P probably benign Het
Slc41a1 T C 1: 131,844,377 V415A probably damaging Het
Smarcc2 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 10: 128,487,362 probably benign Het
Snph G A 2: 151,600,387 R43W probably benign Het
Sptan1 A T 2: 29,993,724 probably benign Het
Supt20 C A 3: 54,709,085 H254Q probably benign Het
Taar7a A G 10: 23,993,148 C112R probably damaging Het
Tbc1d4 T C 14: 101,507,572 Y206C probably damaging Het
Tecta A G 9: 42,337,208 V1961A probably damaging Het
Tgfbr1 T A 4: 47,383,948 Y30* probably null Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tnfrsf1b C A 4: 145,227,497 C94F probably damaging Het
Ttn A G 2: 76,749,396 Y23718H probably damaging Het
Ube2i T C 17: 25,265,294 probably benign Het
Vmn2r16 G T 5: 109,330,525 V49F probably benign Het
Zfp955a T C 17: 33,242,618 Y180C probably benign Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Zscan18 T A 7: 12,775,289 probably benign Het
Other mutations in Vps45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Vps45 APN 3 96000066 makesense probably null
IGL00848:Vps45 APN 3 96056973 splice site probably benign
IGL00915:Vps45 APN 3 96046350 critical splice donor site probably null
IGL02143:Vps45 APN 3 96033821 missense probably benign
IGL02143:Vps45 APN 3 96019646 missense probably benign 0.00
IGL02247:Vps45 APN 3 96042924 missense probably damaging 1.00
IGL02598:Vps45 APN 3 96031042 missense probably benign 0.03
IGL03409:Vps45 APN 3 96053089 missense probably benign 0.00
R0943:Vps45 UTSW 3 96057024 missense probably benign 0.02
R1102:Vps45 UTSW 3 96042941 splice site probably benign
R1540:Vps45 UTSW 3 96048346 missense probably damaging 1.00
R1829:Vps45 UTSW 3 96047245 critical splice donor site probably null
R1919:Vps45 UTSW 3 96046440 missense probably benign 0.00
R2113:Vps45 UTSW 3 96047053 missense probably benign 0.05
R2251:Vps45 UTSW 3 96057040 missense probably benign 0.00
R2511:Vps45 UTSW 3 96041445 missense probably benign 0.01
R4752:Vps45 UTSW 3 96048387 missense possibly damaging 0.88
R4806:Vps45 UTSW 3 96046413 missense probably benign 0.01
R4914:Vps45 UTSW 3 96019631 missense probably damaging 0.98
R4915:Vps45 UTSW 3 96019631 missense probably damaging 0.98
R4917:Vps45 UTSW 3 96019631 missense probably damaging 0.98
R5288:Vps45 UTSW 3 96057774 start codon destroyed probably null 1.00
R5454:Vps45 UTSW 3 96019657 missense probably benign 0.21
R6397:Vps45 UTSW 3 96042852 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AGCTGCCTTGATGACAGAGG -3'
(R):5'- TTTTACAGGAGGCCCATGC -3'

Sequencing Primer
(F):5'- CTGCCTTGATGACAGAGGGACAG -3'
(R):5'- CCATGCGGGAGGGAAAACTG -3'
Posted On2016-07-06