Incidental Mutation 'R5180:Ampd2'
ID399694
Institutional Source Beutler Lab
Gene Symbol Ampd2
Ensembl Gene ENSMUSG00000027889
Gene Nameadenosine monophosphate deaminase 2
Synonyms1200014F01Rik, Ampd-2
MMRRC Submission 042760-MU
Accession Numbers

Genbank: NM_028779; MGI: 88016

Is this an essential gene? Possibly non essential (E-score: 0.272) question?
Stock #R5180 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location108074062-108086651 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 108079042 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 273 (Q273K)
Ref Sequence ENSEMBL: ENSMUSP00000099698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078912] [ENSMUST00000102637] [ENSMUST00000102638]
Predicted Effect probably benign
Transcript: ENSMUST00000078912
AA Change: Q299K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000077946
Gene: ENSMUSG00000027889
AA Change: Q299K

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
Pfam:A_deaminase 357 764 3.3e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102637
AA Change: Q273K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099697
Gene: ENSMUSG00000027889
AA Change: Q273K

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:A_deaminase 331 738 7.5e-125 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102638
AA Change: Q273K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099698
Gene: ENSMUSG00000027889
AA Change: Q273K

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:A_deaminase 331 738 7.5e-125 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106667
SMART Domains Protein: ENSMUSP00000102278
Gene: ENSMUSG00000027889

DomainStartEndE-ValueType
Pfam:A_deaminase 1 42 5.2e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127232
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136712
SMART Domains Protein: ENSMUSP00000122431
Gene: ENSMUSG00000027889

DomainStartEndE-ValueType
Pfam:A_deaminase 97 165 4.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149479
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153626
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is important in purine metabolism by converting AMP to IMP. The encoded protein, which acts as a homotetramer, is one of three AMP deaminases found in mammals. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit proteinuria, tubules filled with protein casts and podocyte process effacement. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,466,510 T4091A probably benign Het
Adgrv1 G A 13: 81,283,416 probably benign Het
Ago3 C T 4: 126,367,751 V435I probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ankrd35 C A 3: 96,680,473 H109Q probably damaging Het
Atpaf2 A G 11: 60,405,869 L153S possibly damaging Het
C1qtnf7 G A 5: 43,615,814 V152M probably benign Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep295 C T 9: 15,332,120 C1680Y probably benign Het
Cyp4f15 A T 17: 32,690,740 I104F probably benign Het
Daam1 A G 12: 71,947,125 N434S unknown Het
Dab2ip C T 2: 35,720,491 P782L possibly damaging Het
Dhx34 C A 7: 16,205,480 G663* probably null Het
Dnah7a T C 1: 53,423,287 D3715G probably damaging Het
Dnajc11 C T 4: 151,969,939 R201C probably damaging Het
Erf A T 7: 25,246,265 I27N probably damaging Het
Fbxl7 T A 15: 26,543,421 Y380F probably damaging Het
Gm3336 A G 8: 70,720,461 probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm5134 T C 10: 75,976,366 Y152H probably damaging Het
Gm6899 A G 11: 26,593,795 probably benign Het
Gna11 T C 10: 81,544,873 K19E probably benign Het
Gpr15 C A 16: 58,717,885 L280F probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Ino80d C A 1: 63,086,329 probably benign Het
Irak3 T G 10: 120,145,782 K406T probably damaging Het
Kif15 G A 9: 122,999,210 C634Y probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Macrod2 A T 2: 140,395,716 E14V probably damaging Het
Matn3 T A 12: 8,955,374 D261E probably benign Het
Mdga1 A T 17: 29,857,736 probably benign Het
Natd1 G T 11: 60,913,656 R24S probably benign Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Olfr1453 A T 19: 13,027,412 S306T probably benign Het
Parp9 T A 16: 35,953,736 Y81* probably null Het
Pde4d A G 13: 109,740,473 N73S probably benign Het
Pigb A T 9: 73,034,590 I129N probably damaging Het
Plxnb1 C A 9: 109,111,693 probably null Het
Ppfibp1 G T 6: 147,027,321 R813L probably damaging Het
Ramp3 T A 11: 6,658,619 L16Q unknown Het
Slc35a4 T C 18: 36,682,635 S173P probably benign Het
Slc41a1 T C 1: 131,844,377 V415A probably damaging Het
Smarcc2 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 10: 128,487,362 probably benign Het
Snph G A 2: 151,600,387 R43W probably benign Het
Sptan1 A T 2: 29,993,724 probably benign Het
Supt20 C A 3: 54,709,085 H254Q probably benign Het
Taar7a A G 10: 23,993,148 C112R probably damaging Het
Tbc1d4 T C 14: 101,507,572 Y206C probably damaging Het
Tecta A G 9: 42,337,208 V1961A probably damaging Het
Tgfbr1 T A 4: 47,383,948 Y30* probably null Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tnfrsf1b C A 4: 145,227,497 C94F probably damaging Het
Ttn A G 2: 76,749,396 Y23718H probably damaging Het
Ube2i T C 17: 25,265,294 probably benign Het
Vmn2r16 G T 5: 109,330,525 V49F probably benign Het
Vps45 A G 3: 96,046,371 I223T possibly damaging Het
Zfp955a T C 17: 33,242,618 Y180C probably benign Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Zscan18 T A 7: 12,775,289 probably benign Het
Other mutations in Ampd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ampd2 APN 3 108077396 missense probably damaging 1.00
IGL02142:Ampd2 APN 3 108080344 splice site probably benign
IGL02174:Ampd2 APN 3 108080285 missense probably damaging 0.96
IGL02686:Ampd2 APN 3 108076495 missense possibly damaging 0.62
IGL03326:Ampd2 APN 3 108079287 missense probably benign 0.02
IGL03493:Ampd2 APN 3 108075358 missense probably damaging 1.00
D4186:Ampd2 UTSW 3 108081111 missense probably benign 0.00
H8562:Ampd2 UTSW 3 108081111 missense probably benign 0.00
PIT4445001:Ampd2 UTSW 3 108075012 missense probably damaging 1.00
R0271:Ampd2 UTSW 3 108086716 unclassified probably benign
R0835:Ampd2 UTSW 3 108076502 missense possibly damaging 0.48
R0975:Ampd2 UTSW 3 108077121 missense probably damaging 1.00
R1061:Ampd2 UTSW 3 108075689 missense probably damaging 1.00
R1466:Ampd2 UTSW 3 108080337 critical splice acceptor site probably null
R1466:Ampd2 UTSW 3 108080337 critical splice acceptor site probably null
R1584:Ampd2 UTSW 3 108080337 critical splice acceptor site probably null
R2034:Ampd2 UTSW 3 108077363 missense possibly damaging 0.91
R2164:Ampd2 UTSW 3 108085369 intron probably benign
R3040:Ampd2 UTSW 3 108076416 missense probably damaging 1.00
R3052:Ampd2 UTSW 3 108086487 utr 5 prime probably benign
R4329:Ampd2 UTSW 3 108077787 intron probably benign
R4425:Ampd2 UTSW 3 108086736 unclassified probably benign
R5073:Ampd2 UTSW 3 108079233 missense probably damaging 0.99
R5074:Ampd2 UTSW 3 108079233 missense probably damaging 0.99
R5256:Ampd2 UTSW 3 108079549 intron probably benign
R5507:Ampd2 UTSW 3 108077613 missense probably damaging 1.00
R5513:Ampd2 UTSW 3 108075667 missense possibly damaging 0.85
R5955:Ampd2 UTSW 3 108079772 missense probably damaging 1.00
R6941:Ampd2 UTSW 3 108079293 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTAGCTGAAGACAGGAGCAC -3'
(R):5'- ATGAGCACTGTGAGCCAAG -3'

Sequencing Primer
(F):5'- TTAGCTGAAGACAGGAGCACAGAAG -3'
(R):5'- TGTGGTGCACGTCTACAC -3'
Posted On2016-07-06